ID: 901526107

View in Genome Browser
Species Human (GRCh38)
Location 1:9824171-9824193
Sequence CGCCTGGAGCGCGCGCCCGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 149}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901526098_901526107 -4 Left 901526098 1:9824152-9824174 CCTCCGAGCCCGTCGGCCCCGCC 0: 1
1: 0
2: 3
3: 42
4: 337
Right 901526107 1:9824171-9824193 CGCCTGGAGCGCGCGCCCGCGGG 0: 1
1: 0
2: 1
3: 13
4: 149
901526095_901526107 14 Left 901526095 1:9824134-9824156 CCCGGCAGCGGGCGCGCGCCTCC 0: 1
1: 0
2: 0
3: 24
4: 228
Right 901526107 1:9824171-9824193 CGCCTGGAGCGCGCGCCCGCGGG 0: 1
1: 0
2: 1
3: 13
4: 149
901526096_901526107 13 Left 901526096 1:9824135-9824157 CCGGCAGCGGGCGCGCGCCTCCG 0: 1
1: 0
2: 0
3: 19
4: 163
Right 901526107 1:9824171-9824193 CGCCTGGAGCGCGCGCCCGCGGG 0: 1
1: 0
2: 1
3: 13
4: 149
901526099_901526107 -7 Left 901526099 1:9824155-9824177 CCGAGCCCGTCGGCCCCGCCTGG 0: 1
1: 0
2: 1
3: 21
4: 194
Right 901526107 1:9824171-9824193 CGCCTGGAGCGCGCGCCCGCGGG 0: 1
1: 0
2: 1
3: 13
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901526107 Original CRISPR CGCCTGGAGCGCGCGCCCGC GGG Exonic
901049440 1:6419046-6419068 CGCCGTGAGCGCGCGCCTGCTGG - Exonic
901242863 1:7704951-7704973 CGCCCCGCGCGCGCCCCCGCCGG - Intronic
901526107 1:9824171-9824193 CGCCTGGAGCGCGCGCCCGCGGG + Exonic
903492899 1:23743295-23743317 CGCGAGGAGTGCGCGGCCGCCGG + Exonic
905173973 1:36125056-36125078 CGCCCGGCGGCCGCGCCCGCAGG - Exonic
907863778 1:58379041-58379063 CGCATGGTGCGCGCACCCACTGG + Intronic
912494831 1:110084632-110084654 AGCCGGGAGCGCGGGCGCGCGGG + Intergenic
914702905 1:150150233-150150255 CGCCCCGCGCCCGCGCCCGCTGG + Exonic
915214126 1:154328848-154328870 CGGGTGGGGCGCGCGCCCGACGG + Intronic
915247667 1:154567990-154568012 CGGCTGGAGCGCGCCGCCGGGGG - Exonic
921879990 1:220245298-220245320 CGCATGGTGCGCGCACCCACTGG - Intronic
922505273 1:226122288-226122310 CGCCTGGAAGGCGCGCGAGCCGG - Intergenic
922958562 1:229625823-229625845 CGCGAGGCGCGCGCGCGCGCGGG - Intronic
924465054 1:244291956-244291978 CGCCTGGGGCTCTGGCCCGCTGG + Intergenic
924527075 1:244863059-244863081 CGCGGGGAGCGCGGGCCCGCGGG - Intronic
1064418079 10:15168175-15168197 CGCCTGTTGCCCTCGCCCGCGGG - Intronic
1073063376 10:100745084-100745106 CGCCTGGGCCGCGCGGCCCCGGG - Intronic
1073241966 10:102065208-102065230 CGCCTGGACCGCGCCCGCCCGGG - Intergenic
1074903328 10:117838748-117838770 CGCATGGTGCGCGCACCCACTGG + Intergenic
1075698103 10:124450212-124450234 CGCCCGGTGCGCGCGACCGCGGG + Intergenic
1076371610 10:129959324-129959346 CGCAAGGAGCGAGAGCCCGCTGG + Intronic
1076372389 10:129963935-129963957 CGTCCGGAGCGCCCGGCCGCTGG - Intergenic
1076612698 10:131736607-131736629 CTCCTGGAGCCCGGGCCTGCAGG - Intergenic
1076722050 10:132397056-132397078 GGCCGGGGGCGCGCGGCCGCGGG - Intergenic
1077368363 11:2170399-2170421 AGCCAGGAGCGGGCGCCTGCGGG - Intronic
1080779567 11:35418579-35418601 CGCCTGGAGCGCGGCGCCCCAGG - Intronic
1083758281 11:64802817-64802839 CGCCCGCACCCCGCGCCCGCGGG + Intronic
1087615436 11:100481579-100481601 CGCATGGTGCGCGCACCCACTGG + Intergenic
1088204095 11:107372902-107372924 CGCATGGTGCGCGCACCCACTGG - Intronic
1092256361 12:6928399-6928421 CGCCTGGGCCCCGGGCCCGCGGG + Intronic
1096143755 12:49264467-49264489 CGAGGGGAGCGGGCGCCCGCGGG + Intronic
1096529405 12:52233688-52233710 CGCCTGGCCCGCGCGCAGGCAGG - Intronic
1097383254 12:58920271-58920293 GGCCCCGAGCGCGCGCCGGCTGG - Exonic
1101447594 12:104748516-104748538 CACCTGGAGCGCATGCCCGGTGG + Intronic
1103085683 12:118060863-118060885 CGCCGGGCGCGCACCCCCGCCGG + Intronic
1103556626 12:121770573-121770595 TGCCTGGAGCGCCCGCGTGCTGG + Intronic
1103565270 12:121812137-121812159 CGCCAGCAGGGGGCGCCCGCGGG - Intronic
1103595392 12:122022050-122022072 AGGCTGGGGAGCGCGCCCGCCGG - Exonic
1104961463 12:132490280-132490302 CGCATGGGGCGCGCCCCCGGGGG + Exonic
1108363774 13:49691088-49691110 CGCCTGGAGGCCGCGGCGGCCGG - Intronic
1110860366 13:80340355-80340377 CCCCTAGAGCGCGGGCGCGCGGG + Intronic
1113200778 13:107866273-107866295 CGCCAGGAGCGCGGGCCAGGAGG + Exonic
1113962180 13:114132318-114132340 CGCCTGGAGGGCGTCTCCGCCGG + Intronic
1115399337 14:32939461-32939483 CTCCTGGGCCGCGAGCCCGCGGG + Intronic
1122145219 14:99684631-99684653 CGCCTAGTGCGCGCGGCCGCTGG + Intronic
1128328766 15:66742267-66742289 CGCCCTGAGCGCGTGCCCTCTGG + Intronic
1128982539 15:72197803-72197825 CGCCGGGACCCAGCGCCCGCCGG + Intergenic
1131056619 15:89378840-89378862 CGCGGGGGGCGCGCGCCCACAGG + Intergenic
1132606550 16:796031-796053 CGCCAGGAGCGCACGCCCGATGG + Exonic
1133034669 16:3028140-3028162 CGCCTGGGCCCCGGGCCCGCCGG - Exonic
1134584083 16:15396102-15396124 CTGCTGGAGCGCGCGCTCCCGGG + Exonic
1136192208 16:28623214-28623236 CTGCTGGAGCGCGCGCTCCCGGG - Exonic
1137398861 16:48136750-48136772 TGCCTGGAGTGCGCTCCTGCTGG - Intronic
1139475793 16:67201995-67202017 GACCTGGAGCGCGTGCCCCCCGG + Exonic
1141841978 16:86579276-86579298 CGCCTGCAGGCAGCGCCCGCGGG + Exonic
1142120152 16:88383119-88383141 CGCCCGGGCCGCCCGCCCGCCGG - Intergenic
1142464106 17:118476-118498 CGGCGGGATCGCGCGCCCTCTGG + Intergenic
1142474227 17:180305-180327 CGCCAGGAGCGCCCACCGGCCGG + Intronic
1147139673 17:38454000-38454022 CGCGTGGAGCGCGCGGGGGCCGG + Intronic
1147705285 17:42421777-42421799 CGCCTGGCCCCCGCCCCCGCAGG + Intronic
1147969161 17:44210512-44210534 CGCGGGGAGCGCGCGCCCCCTGG - Intronic
1148216528 17:45836568-45836590 CGCCTGGAGCTCCCTTCCGCTGG + Intergenic
1149712439 17:58755842-58755864 TGCCTGGAGAGGGCTCCCGCAGG - Intergenic
1151665315 17:75542345-75542367 TGCCTGGAGCACGCGCCTCCAGG + Intronic
1152378427 17:79930177-79930199 GGGCGGGATCGCGCGCCCGCTGG + Intergenic
1152663284 17:81552764-81552786 CGGCTGGAGTGCGCTCCGGCAGG - Intronic
1152689727 17:81712486-81712508 CGCCTGCTGCACGCACCCGCTGG + Exonic
1154188540 18:12208294-12208316 CGCCCGGTGCGCGCACCCACTGG + Intergenic
1154196598 18:12271686-12271708 CCCCTGGAGCGCGTGGCCGGCGG - Intronic
1155221400 18:23689463-23689485 CGGCTGGAGCGGGCACCAGCCGG - Exonic
1159045755 18:63367281-63367303 CGCCTGGGTGGCGCGCGCGCCGG - Exonic
1160453323 18:78979715-78979737 CTCCCGGAGCGAGCGGCCGCGGG - Intergenic
1160594570 18:79964761-79964783 GTCCCGCAGCGCGCGCCCGCCGG - Exonic
1160927911 19:1555888-1555910 CGCCAGGACAGCGCGCCCACCGG + Exonic
1161450718 19:4343896-4343918 CGCCTGGTGAGCGCGCCCCCGGG - Exonic
1161550629 19:4910253-4910275 CGCGGGGCGCGCGCGCTCGCGGG + Intronic
1163154524 19:15432607-15432629 GCCCGGGAGCGCGCGCCCGCGGG - Intronic
1164713363 19:30374981-30375003 CGCCTGGAGATCGGGCGCGCGGG + Intronic
1167072777 19:47230540-47230562 CACCCAGGGCGCGCGCCCGCTGG - Intronic
930651876 2:53971256-53971278 CGCTTGGAGTGCGCGACCCCCGG - Intronic
932042816 2:68318815-68318837 CGCCTGGACCGCGCGCAGGAGGG + Intronic
933876276 2:86623899-86623921 GGCCTGCAGGGTGCGCCCGCAGG + Intronic
934488146 2:94737316-94737338 CGGCTGGAGGGCGCCACCGCGGG - Intergenic
934746172 2:96761043-96761065 CGCCAGGAGGAGGCGCCCGCGGG - Exonic
938148979 2:128864851-128864873 CGCCCGGTGCGCGCACCCACTGG + Intergenic
940775216 2:157876759-157876781 CGCCTGCCCCGCGCGCCCTCGGG - Intronic
941021018 2:160407898-160407920 CGCCCTGAGAGCGCGCCGGCCGG + Intronic
941061910 2:160856584-160856606 CGCCCGGTGCGCGCACCCACTGG + Intergenic
942292525 2:174486840-174486862 CCCCTGGAGCGCGGACCTGCTGG - Intronic
1170999434 20:21397425-21397447 GGCCTGGGGCGCGCGCCGGCAGG + Exonic
1171223216 20:23420518-23420540 CGCCTGGAACGCGCACCTGGGGG - Intronic
1173649163 20:44651901-44651923 CGGCTGGAGCGCGCGCCCACAGG - Intronic
1175975628 20:62709064-62709086 CGACTGGACGGCGCGCCCGCTGG + Exonic
1176194447 20:63830935-63830957 CCCCGGGAGGGCGCCCCCGCGGG + Intronic
1176341074 21:5696645-5696667 CTCCTGGAGTCCGCGACCGCTGG - Intergenic
1176473328 21:7128798-7128820 CTCCTGGAGTCCGCGACCGCTGG - Intergenic
1176503753 21:7627811-7627833 CTCCTGGAGTCCGCGACCGCTGG + Intergenic
1182511436 22:30822871-30822893 AGCCGGGAGCGCACGCCGGCGGG - Intronic
1183418507 22:37696802-37696824 CGCCTGCAGCCCTTGCCCGCTGG - Intronic
1184101500 22:42343728-42343750 CGCCGGGAGCCCGCGCCGCCCGG - Intergenic
1184412109 22:44331529-44331551 AGCCGGGAGCCGGCGCCCGCGGG + Intergenic
1203240340 22_KI270733v1_random:11103-11125 CTCCTGGAGTCCGCGACCGCTGG - Intergenic
950509993 3:13420293-13420315 GGCCTGGCGCGCGCGCGGGCGGG - Exonic
954823008 3:53347667-53347689 CGCCCGGAGCGTGCGCGCGGCGG - Intergenic
961322103 3:126083614-126083636 CTCCTGCAGCGCCCGCGCGCAGG - Intronic
963119317 3:141762988-141763010 CGCCCGGTGCGCGCACCCACTGG + Intergenic
964960127 3:162411731-162411753 CGCATGGTGCGCGCACCCACTGG + Intergenic
965590591 3:170357506-170357528 CGCCGCGCGCGCGGGCCCGCCGG - Intergenic
968353436 3:198081104-198081126 CGCCTGGAGCTTGGGCCCTCAGG + Intergenic
968515078 4:1012342-1012364 CGCCTGGAGCGCGGGCGGGGAGG + Intronic
968556541 4:1248812-1248834 CGGACCGAGCGCGCGCCCGCGGG - Intronic
968809357 4:2793059-2793081 CGCCAGGCGCTCCCGCCCGCGGG - Intronic
968907954 4:3463267-3463289 GGCCAGGAGGGCGGGCCCGCGGG - Intergenic
969619161 4:8270261-8270283 CGCCTGCAGCGCGCACACGTTGG - Exonic
970637133 4:18021829-18021851 GCCCCGGAGCGCGCGCCCCCCGG + Exonic
980448780 4:132944552-132944574 CGCCCGGTGCGCGCACCCACTGG - Intergenic
982198156 4:152936381-152936403 CGCCGGGAGCGGGGGCGCGCTGG + Exonic
989576365 5:42992089-42992111 CGCCTGGTGCCCGCGCTTGCCGG + Intergenic
990557702 5:56952042-56952064 GGGCTGGAGCGGGCGCCCGGCGG - Intronic
991391082 5:66144273-66144295 GGCCGCGAGCGCGCTCCCGCTGG - Exonic
992487568 5:77210807-77210829 CGCCCGGACTGCGCGCCCCCCGG - Intronic
997253716 5:132410998-132411020 AGCCTGGAGCGCGGGCCCTGGGG + Exonic
997654426 5:135544756-135544778 CGCGGGGCGTGCGCGCCCGCCGG - Intergenic
1002784775 6:392615-392637 CCCCTGGAACGCCCGGCCGCAGG + Intronic
1003604016 6:7542794-7542816 CCCCAGGTGCGCTCGCCCGCGGG - Intronic
1006860761 6:37170357-37170379 CGGCGGGAGGGCGCGCCAGCGGG - Exonic
1007872944 6:45062591-45062613 CGCATGGTGCGCGCACCCACTGG - Intronic
1010428156 6:75749118-75749140 CTCCCGGAGCGCGCGCCCGACGG + Intergenic
1012791908 6:103709172-103709194 CGCCCGGTGCGCGCACCCACTGG - Intergenic
1012854778 6:104489536-104489558 CGCCCGGTGCGCGCACCCACTGG - Intergenic
1018354267 6:162995602-162995624 CGCCTGGTGCGTGCACCCACTGG + Intronic
1018533055 6:164787819-164787841 CGCCTGGTGCGTGCACCCACTGG + Intergenic
1019343457 7:519041-519063 CGGCTGGAGCGCCCGCCCCGCGG - Exonic
1020000853 7:4754703-4754725 CACCTCGAGCACACGCCCGCAGG - Intronic
1021671104 7:23035871-23035893 CGCCCGGTGCGCGCACCCACTGG - Intergenic
1021933170 7:25603164-25603186 CGCATGGTGCGCGCACCCACTGG - Intergenic
1021992505 7:26152133-26152155 CGCCCGGGGCCCGCGCCCGTGGG - Intergenic
1023879454 7:44309893-44309915 CTCCTGGAGCGGCGGCCCGCGGG + Intronic
1024621220 7:51159125-51159147 CGCCAGGTGCGCGCGGCCGGGGG - Intronic
1035697199 8:1607670-1607692 CGCCCGGTGCGCGCACCCACTGG - Intronic
1035725713 8:1823949-1823971 GTCCCGGATCGCGCGCCCGCCGG - Intergenic
1037146822 8:15582170-15582192 CGCATGGTGCGCGCACCCACTGG + Intronic
1038554207 8:28494841-28494863 CGCCCGAAGCGCGCGCCGCCAGG + Intronic
1041838956 8:62248137-62248159 TGCCTGGAGGGCGCCCCTGCTGG - Intergenic
1042903039 8:73746994-73747016 TGCCGGGCGCGCGCGCCGGCCGG - Intronic
1044101650 8:88148991-88149013 CGCCCGGTGCGCGCACCCACTGG - Intronic
1051079608 9:13279331-13279353 CGCCCTGCGCGCGCGCCGGCGGG - Intronic
1051203861 9:14664139-14664161 CGCACGGTGCGCGCACCCGCTGG - Intronic
1052982305 9:34458268-34458290 CCCCTGGCCCGCTCGCCCGCCGG - Exonic
1057881492 9:98796140-98796162 CGGCTGGAGCGCGCTCATGCAGG - Exonic
1058663167 9:107283934-107283956 GGCGTGGAGCGCACGCCCGCGGG + Intronic
1059414715 9:114155755-114155777 GGCCTGGCGCGGGCGCCCGCGGG + Exonic
1060106496 9:120876474-120876496 CTCCCGGAGCGGGCCCCCGCGGG + Intronic
1062084552 9:134641991-134642013 CGGCTGGCGCGCTCGCCCACGGG - Exonic
1062346618 9:136118144-136118166 GGCCTGGAGCTCGCCCCGGCCGG + Intronic
1062435665 9:136545645-136545667 CGCCCGGCGCGCGCGCCCCACGG - Intronic
1203421993 Un_GL000195v1:1348-1370 CTCCTGGAGTCCGCGACCGCTGG + Intergenic
1187421947 X:19142812-19142834 CGCCCGGTGCGCGCACCCACTGG - Intergenic
1187513714 X:19946135-19946157 CGCCCGGTGCGCGCACCCACTGG + Intronic
1187826144 X:23334633-23334655 CTCCGGGAGGGCGCGGCCGCGGG + Exonic
1188166970 X:26873934-26873956 CGCTTGGAGCGGCCGGCCGCCGG - Intergenic
1189821304 X:44872686-44872708 CCCCTGGAGCGCGCGCGGGACGG + Intergenic
1190910791 X:54770240-54770262 CGCATGGTGCGCGCACCCACTGG + Intronic
1194977320 X:100408685-100408707 CGCCTGTTGCGCGCGCCCCGTGG + Exonic