ID: 901526405

View in Genome Browser
Species Human (GRCh38)
Location 1:9825483-9825505
Sequence CCGGGCCAGGCAGGTGCTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 214}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901526405_901526417 17 Left 901526405 1:9825483-9825505 CCCAAAGCACCTGCCTGGCCCGG 0: 1
1: 0
2: 1
3: 16
4: 214
Right 901526417 1:9825523-9825545 CCCACCACTCCTTCCAGCCAAGG 0: 1
1: 0
2: 4
3: 51
4: 505

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901526405 Original CRISPR CCGGGCCAGGCAGGTGCTTT GGG (reversed) Intergenic
900105530 1:979343-979365 GGGGGCGAGGCAGGTGCTTGAGG + Exonic
900381258 1:2385198-2385220 CCTGGCGAGGCAGGAGCTCTTGG - Intronic
900460794 1:2801356-2801378 AAGGGCCTGGCAGGTGCTCTCGG - Intronic
901526405 1:9825483-9825505 CCGGGCCAGGCAGGTGCTTTGGG - Intergenic
901690335 1:10969096-10969118 CCGGTCCCAGAAGGTGCTTTAGG + Intronic
902816831 1:18921221-18921243 CTGGGCAAGGAAGGTGCATTGGG + Intronic
903772128 1:25770593-25770615 CCCTGCAAGGCAGGTGCTATCGG - Intronic
905402548 1:37714245-37714267 CCGGGCCATTCATGTTCTTTAGG - Intronic
905626903 1:39495309-39495331 CCGTGCAGAGCAGGTGCTTTAGG + Intronic
905670033 1:39785462-39785484 CCGTGCAGAGCAGGTGCTTTAGG - Intronic
906287457 1:44596707-44596729 CTGGGCCAGCCAGGTCCCTTGGG - Intronic
907551998 1:55312507-55312529 CTGGTCCAGGCAGGTCCTTTTGG + Intergenic
908309291 1:62860251-62860273 CAGCCTCAGGCAGGTGCTTTAGG - Intronic
915062707 1:153199457-153199479 CTGGGCTTGGCAGGTGCTTATGG - Intergenic
915479892 1:156177332-156177354 CTGGGACAGGCAGGTTTTTTAGG - Exonic
915637176 1:157195255-157195277 CCCTGCCAGGGGGGTGCTTTCGG - Intergenic
915720842 1:157984466-157984488 CTGGGCCAGGCACCTGCTCTGGG - Intergenic
917811668 1:178664415-178664437 CCGGTCCAGGCAGCTGTTGTGGG - Intergenic
919314614 1:195955172-195955194 AGGAGCCAGGCAAGTGCTTTTGG - Intergenic
920172546 1:204080747-204080769 CAGAGGCAGGCAGGTGCTGTGGG + Intronic
921722175 1:218484933-218484955 CAGGCTCAGGCAGGTCCTTTAGG + Intergenic
922155798 1:223038969-223038991 CCTGGCCTTGCAGCTGCTTTTGG - Intergenic
922918220 1:229276286-229276308 CCGGGCCGTGCAGGTGCTGTTGG + Intronic
922936423 1:229426442-229426464 CAGGGCCAGTCAAGTGCTTGGGG + Intergenic
1063586592 10:7358246-7358268 CAGGGCCATGCAGGTGTTCTAGG - Intronic
1063586636 10:7358493-7358515 CAGGGCCATGCAGGTGTTCTAGG - Intronic
1064824070 10:19375495-19375517 CAGGGCCTTGCAGGTGATTTTGG - Intronic
1067087905 10:43252542-43252564 CCTGGCCAGGCAGTTGGGTTTGG - Intronic
1070150309 10:73801129-73801151 CCGGGGCACGCAGGTGGTTGTGG - Exonic
1070796189 10:79218087-79218109 AAGGGCCAGACAGGGGCTTTTGG + Intronic
1071298034 10:84236843-84236865 CAGGACCAGGCAGGTGCCTTGGG + Intronic
1071567638 10:86680013-86680035 CCTGCCCAGGCAGGAGCTTCTGG + Intronic
1073475155 10:103747715-103747737 CCTGGCCAGGCCTGTGGTTTTGG - Intronic
1075670856 10:124263239-124263261 CCGTGCCAGGCATCTGCTTGTGG - Intergenic
1075949730 10:126466614-126466636 CATGTCCAGGAAGGTGCTTTGGG - Intronic
1076333011 10:129685317-129685339 CCAGGCCAGGCAGGAAGTTTTGG - Intronic
1076344739 10:129772639-129772661 CCGGGACTGGCAGGTTCTCTAGG + Intergenic
1076671038 10:132121225-132121247 CCGGGCCTGGCAGGAGCTGCAGG + Intronic
1077121012 11:908528-908550 CCTGGCCAGGCAAGTGATTCTGG - Intronic
1078021224 11:7657302-7657324 CTGGGCAAGGCAGGTGTTTAGGG + Intergenic
1078055306 11:8004257-8004279 GCGGGCCAGTGAGATGCTTTAGG - Intergenic
1079105563 11:17570133-17570155 GCGGGCCAGGCAGGTGGTGGTGG + Intronic
1083173139 11:60934620-60934642 CGGGGCCAAGCAGGTGCGTGAGG - Exonic
1084916760 11:72434374-72434396 CGGGGCCATGGAGGTGCTTCCGG - Exonic
1084967411 11:72751851-72751873 CTGGGCCAGGTAGGGGCTCTGGG + Intronic
1085010846 11:73141211-73141233 CCGGGCCCGGGAGGTGCGTGGGG - Intronic
1085426395 11:76408604-76408626 CAGGGCCAGGAAGGTGCTGGTGG + Intronic
1092214778 12:6673308-6673330 CTGGGCCAGGTAGGAGCTGTTGG + Exonic
1092985174 12:13838262-13838284 ATGGACCACGCAGGTGCTTTGGG - Intronic
1096217237 12:49804632-49804654 CAGAGCCAGGCAGAGGCTTTTGG - Intronic
1102031620 12:109743235-109743257 CCCTGCCAGTCAGGGGCTTTGGG + Intronic
1102146797 12:110660399-110660421 CCAGGACAGGCAGGTATTTTGGG + Intronic
1103303802 12:119948468-119948490 TTGGGCCAGGCATGTGCCTTAGG + Intergenic
1103379492 12:120482817-120482839 CCAGGCCAGACATGGGCTTTGGG + Intronic
1103727570 12:123005621-123005643 GGGGCCCAGGCAGGGGCTTTGGG + Intronic
1103998944 12:124847943-124847965 AGGGGCCAGGCGGGTGCTTTTGG - Intronic
1104754994 12:131263770-131263792 GAGGGGCAGGGAGGTGCTTTGGG + Intergenic
1108504824 13:51103151-51103173 CAGAGCCAGGCTGCTGCTTTGGG - Intergenic
1108530106 13:51320629-51320651 CAGAGCCAGGGAGCTGCTTTGGG - Intergenic
1112556016 13:100469292-100469314 CCAGGCAAAGCAGGTACTTTTGG + Intronic
1112718062 13:102209542-102209564 TAGGGCCAGGCAGGTCCCTTTGG + Intronic
1114253831 14:20984970-20984992 CAGGGCCAGGGTGCTGCTTTTGG - Intergenic
1115993210 14:39170547-39170569 CCGGGCCAGGCGGGAGCTTTAGG - Intergenic
1119053323 14:71392185-71392207 CCGGTGCAGGCAGATGCTTCAGG + Intronic
1121174374 14:91879730-91879752 CCGGGACAGGCGGATCCTTTAGG - Intronic
1124404850 15:29383593-29383615 CCGGGTCTGGCCAGTGCTTTTGG - Intronic
1129454183 15:75667653-75667675 CCTGGGCAGTCAGGTTCTTTGGG + Intergenic
1131020189 15:89090935-89090957 CCAGGCCAGGCAGGCGCTGCTGG - Intronic
1132275360 15:100558979-100559001 CCGGGCCAGGCCGGAGCGCTCGG + Intergenic
1132696122 16:1202744-1202766 CGGGGCCAGGCAGGGGCAATGGG - Intronic
1132898314 16:2239150-2239172 CCTGCCCAGGCAGGTGGCTTGGG + Intergenic
1133073759 16:3264168-3264190 CCGGGCCAGGGAGGGGCTGCCGG - Intronic
1133587725 16:7211994-7212016 CCAGGCAAGGCAGGTTATTTGGG - Intronic
1134998077 16:18754776-18754798 CTGGGCCAGACAGCTGGTTTTGG - Intergenic
1137744923 16:50813399-50813421 AGGGGCCAGGCAGGTACCTTAGG + Intergenic
1139973988 16:70794505-70794527 ACGGGCCAGGCAGGAGATATGGG + Intronic
1140529071 16:75648434-75648456 CCTGGCCCCGCAGGTGCTTGAGG - Exonic
1141605806 16:85152682-85152704 GGGGGCCAGGCAGGAGCCTTGGG - Intergenic
1141626061 16:85261685-85261707 CAGGGCCCAGCAGATGCTTTCGG + Intergenic
1142815521 17:2422019-2422041 CCGCGCCCGGCAGGTGCCATTGG - Intronic
1143633222 17:8150595-8150617 CTGGGCAAGGCCGGTGCTGTGGG + Exonic
1144638964 17:16927203-16927225 CCGAGGCAGGCAGGTGCTAGCGG + Intergenic
1144761367 17:17709443-17709465 CCGAGGCAGGCAGGGGCCTTGGG - Intronic
1144852628 17:18251721-18251743 CCAGGCCAAGCAGGTGCTGAAGG - Exonic
1145886967 17:28388643-28388665 CTGGGCCAAGGAGGTGCTTCAGG - Intronic
1145938201 17:28727045-28727067 CCGAGCGAGGCAGCTGCTTTCGG + Intronic
1145977360 17:28992059-28992081 CGAGGCCAGGCAGCTGCTCTGGG - Intronic
1146573151 17:33969868-33969890 CCTAGCGAGGCAGGTGCTGTTGG - Intronic
1148565803 17:48632246-48632268 CAGGGCCAGGGAGGTGCCTCGGG + Intronic
1148810900 17:50290471-50290493 CCAGGACAGGCAGAAGCTTTTGG + Intergenic
1148901919 17:50884849-50884871 AGGGGCCAGGCAGGTGCTTCTGG + Intergenic
1149560191 17:57603090-57603112 CCAGGCCAGTCTGGTGCTCTTGG + Intronic
1150209971 17:63436489-63436511 CTGGGCCGGGCAGCTCCTTTAGG - Intronic
1151232518 17:72694932-72694954 CGAGGCCAGGCAGGTGCTGTGGG + Intronic
1151355573 17:73556009-73556031 CAGGGAAAGGCAGGGGCTTTGGG + Intronic
1152664004 17:81556874-81556896 CAGGACCAGGCAGTTGCTTCAGG + Exonic
1153997536 18:10454862-10454884 CCGGGCCAGGCCGGGGCTTCAGG - Exonic
1156447783 18:37249857-37249879 CAGGGCCAGGCTGTAGCTTTCGG - Intronic
1159005348 18:63005519-63005541 CCGGGCCCAGCAGGTGCTTCTGG + Intergenic
1160527358 18:79545499-79545521 CAGGGCCAGGCAGGAGCTACCGG + Intergenic
1161718634 19:5891549-5891571 CAGGGCCAGGCCGGTGTTCTTGG + Exonic
1161973406 19:7596189-7596211 CCGGGCGCGGCAGGTGCTGGGGG + Intronic
1163015324 19:14451035-14451057 CCCGGCCAGGCGGGTGCTGAAGG - Exonic
1163157651 19:15448235-15448257 CCGGGCCAGGCAGTCTCTCTGGG + Exonic
1163275864 19:16283844-16283866 CAGGGCCGAGCAGGTGGTTTGGG + Intergenic
1163366426 19:16878378-16878400 CCGGGCCAAGCAGGTGCCAGGGG + Exonic
1163723399 19:18909098-18909120 GCGGTCCAGGCAGGGGCTTGTGG - Intronic
1164676788 19:30106534-30106556 AGGCCCCAGGCAGGTGCTTTCGG - Intergenic
1165242735 19:34481260-34481282 CCGGGCCAGGCAGGGGGTCGTGG + Intergenic
1165474907 19:36024831-36024853 CCGAGGCAGGCAGATGCTTGAGG + Intronic
1165725666 19:38110875-38110897 CCAGGCCTGGCTGGTGATTTTGG - Intronic
1166195358 19:41202302-41202324 TCGGGTCAGGCAGCTGCTGTGGG + Intronic
1166960355 19:46493156-46493178 CTGCGCCTGGCAGGTGCTGTAGG - Exonic
1168318645 19:55495464-55495486 CCGAGGCAGGCAGATGGTTTGGG - Intronic
1168642156 19:58037849-58037871 CTGGGGGAGGCAGGGGCTTTGGG - Exonic
1168707082 19:58476382-58476404 CCGGGCCTGGCAAGTCCTCTTGG + Exonic
926334550 2:11853478-11853500 CTGTGGCAGGCAGGTGCCTTGGG + Intergenic
927509079 2:23633065-23633087 CAGGGCCAGGCAGGTGGGATGGG + Intronic
927634147 2:24799752-24799774 CAGGCCCAGGAAGGTGCTCTTGG + Exonic
932809987 2:74817042-74817064 CAGGGCCAGGCAGGTGGCTGGGG - Intergenic
933279960 2:80322585-80322607 CGGGGCCAGGCTGGCGCTTGGGG - Intronic
934301825 2:91781007-91781029 CCGGGATAGAAAGGTGCTTTGGG + Intergenic
934563564 2:95325467-95325489 CCTGGCCAGGCAGGAGGTTCAGG + Intronic
937218387 2:120327229-120327251 TGGGGCCAGACATGTGCTTTAGG + Intergenic
937984418 2:127632179-127632201 CCTGGCCAGGCAGGCACCTTGGG - Intronic
938199086 2:129358322-129358344 CCTGGCCAAGCAGCTCCTTTGGG - Intergenic
940290218 2:152070997-152071019 CCGAGGCAGGCAGATGCTTGAGG - Intronic
941029199 2:160493020-160493042 CCGGGCCAGGAAGGGGCTGGTGG + Intronic
946418127 2:219550802-219550824 CCAGGCCAGGCGGGTGCCCTTGG - Exonic
946419576 2:219557427-219557449 CGGGGCCAGGCAGGTGCTGCGGG - Exonic
1168898470 20:1340045-1340067 CCTGGCCAGGTAGGGGTTTTGGG + Intronic
1169344947 20:4822629-4822651 CCGAGCGAGGCAGGTGCCGTGGG - Intronic
1170536569 20:17346505-17346527 CTGGCCCAGGCAGGCTCTTTGGG + Intronic
1171364644 20:24615563-24615585 CGGGGCCAGGCAGGCTTTTTTGG + Intronic
1173672993 20:44810685-44810707 CCGGGCCCGGCAGGTGCGCGCGG + Intergenic
1174403784 20:50291040-50291062 CCAGACCAGGCAGGTGGGTTAGG + Intergenic
1175561315 20:59933295-59933317 GCTGGCCAGGCAGGTGCTGATGG + Intronic
1175723586 20:61302225-61302247 GAGGGCCAGGGAGCTGCTTTGGG + Intronic
1176159206 20:63640138-63640160 AGGGGCCAGGCAGCAGCTTTGGG + Exonic
1178995959 21:37400056-37400078 CAGGGCCAGGGCTGTGCTTTAGG + Intronic
1179507654 21:41852486-41852508 CCAGGCCAGGCACCTGGTTTTGG + Intronic
1180919682 22:19515052-19515074 AGGGGCCAGGCGGGTGCTGTGGG + Intronic
1181052768 22:20245588-20245610 ACGGGCCAGGGAGGTCTTTTGGG - Intronic
1182128957 22:27836611-27836633 CTGGGCCAGGCATGCACTTTGGG + Intergenic
1182309515 22:29394635-29394657 CCGGGCCTGGCCAGTTCTTTGGG + Intronic
1182482011 22:30615231-30615253 CCAGGACAGGCAGGGGCTTGAGG - Intronic
1183094598 22:35544451-35544473 CTGGGCCAGTCAGGTGGTTGAGG + Intronic
1183582298 22:38733232-38733254 CCTGGCATGGCAGGGGCTTTGGG + Exonic
1184058696 22:42068776-42068798 CTGGGCCAGGCAGTGGCTTGAGG + Intronic
1184431013 22:44441611-44441633 CCAGGCCAGGCATGTGCTATCGG + Intergenic
1184839056 22:47041935-47041957 CAGGGCCAGGCACTTGCTATAGG - Intronic
1185367825 22:50445114-50445136 CCTGGCCGGGCCGGGGCTTTGGG - Exonic
1203226122 22_KI270731v1_random:79387-79409 CCGGGATAGAAAGGTGCTTTGGG + Intergenic
1203264706 22_KI270734v1_random:7399-7421 CCGGGATAGAAAGGTGCTTTGGG - Intergenic
952953991 3:38545336-38545358 CCAGGCCAGGCAGATGGTTAGGG - Intergenic
954256485 3:49411484-49411506 CCGGGCAGGGCGGGGGCTTTGGG - Intronic
954297564 3:49682661-49682683 CCGGGCCACGCAGGCCCTGTAGG - Exonic
955462976 3:59205522-59205544 TCTGGTCAGGCAGGTGTTTTGGG + Intergenic
956177121 3:66483608-66483630 CCTCGCCAGGCAGCTGGTTTCGG - Intronic
957206433 3:77205002-77205024 CCGGGCGGGGCAAGTGCTCTGGG + Intronic
962757132 3:138473647-138473669 TAGGGCCAGGGAGGTCCTTTGGG + Intronic
967881910 3:194307500-194307522 CCGGGCCCTGCAGGTGCTTCTGG - Intergenic
968434988 4:579881-579903 GTGGGCCTGGCAGGTGCTTGGGG - Intergenic
968899413 4:3423986-3424008 CCGGGCCCAGCAGGTGCAGTGGG - Intronic
968916504 4:3499183-3499205 CCTGGACAGGCAGGTGTTTCAGG + Intronic
969309144 4:6342518-6342540 CCGGGCCAGGCACGTCGTTGGGG + Intronic
969595690 4:8148224-8148246 CTGGGCCAGGCAGGTTCTGAAGG + Intronic
972312123 4:37891292-37891314 CCGGGACGCGCAGGTGCTTGGGG - Exonic
974234275 4:59160874-59160896 AGTGGCCAGGCAGGGGCTTTGGG - Intergenic
981079215 4:140622375-140622397 CCGGTCCAGGCTGGTGCTCCGGG + Exonic
981103927 4:140859157-140859179 CATGGCCAGGCAGGAGCTGTGGG - Intergenic
982459554 4:155651705-155651727 GCAGGCCAGGAAGGTGCTCTGGG + Intergenic
989645124 5:43622547-43622569 CGGGGCCAGGCAGGTGGCTCAGG - Intronic
991489066 5:67165752-67165774 CAGGGCCAGGCCGGGGCTTGTGG - Exonic
992770333 5:80041497-80041519 CACGGCCAGGTAGGTGCTTAAGG - Intronic
997698222 5:135878216-135878238 CCGGGCCCTGCAGGAGCTGTGGG - Intronic
1001277129 5:170359166-170359188 CAGTGTCTGGCAGGTGCTTTGGG - Intronic
1002314495 5:178334318-178334340 TCGATCCAGGCATGTGCTTTGGG - Intronic
1002568734 5:180128378-180128400 CCGGGTGAGGAAGGTGGTTTGGG + Intronic
1002717571 5:181237624-181237646 CCAGGCCAGGGAGGTGCACTGGG + Exonic
1003128802 6:3377718-3377740 CTGGGCCAGGCAGAGGCTGTAGG + Intronic
1005900494 6:30213213-30213235 CCGGGCCCGGCGGCTGCGTTGGG + Intronic
1005923940 6:30425006-30425028 CAGCGTCAGGCAGGTCCTTTAGG + Intergenic
1006298089 6:33178954-33178976 CAGGGCCGGGCAGGTGCTGATGG - Exonic
1006874364 6:37282381-37282403 CCAGGCAAGGTAGGAGCTTTGGG + Intronic
1010750736 6:79614034-79614056 CAGGGACTGGCAGGTGCTCTGGG - Intergenic
1012263194 6:97111515-97111537 CAGGACCTGGCAAGTGCTTTTGG + Intronic
1015149210 6:130019800-130019822 CCGAGGCAGGAAAGTGCTTTGGG + Intronic
1016025059 6:139278475-139278497 CCCTGCCAGGCATGTGCTTTGGG + Intronic
1019299265 7:295416-295438 CAGGGCCAGGCAGATGCACTGGG - Intergenic
1019422482 7:957533-957555 CGGGTCCAGGCAGGTACTTGCGG - Intronic
1019491038 7:1313761-1313783 GCAGGCCAGGCGTGTGCTTTAGG + Intergenic
1019950013 7:4364525-4364547 CGTGGCCAGGCAACTGCTTTTGG - Intergenic
1022129189 7:27388375-27388397 CAGGGCCAAGCAGGTGGCTTTGG - Intergenic
1025254285 7:57373010-57373032 CAGGGAAAGGCAGGTGCTTAGGG + Intergenic
1026538640 7:71261306-71261328 ACTTGCCAGGCAGGTGCTTGAGG + Intronic
1027270648 7:76516689-76516711 CAGGGCCAGGTATGTGGTTTAGG + Intergenic
1032547521 7:132756144-132756166 CCTGCTCAGGCAGGTTCTTTGGG - Intergenic
1034563852 7:151898381-151898403 CCCTGCCGGGCAGCTGCTTTGGG - Intergenic
1036434653 8:8722788-8722810 CCTGGCCAGGCAGGTGCTCCTGG - Intergenic
1036740942 8:11361166-11361188 CTGGCCCAGGCAGGTCCTATAGG + Intergenic
1040942340 8:52845862-52845884 CCGGGCCAGCTCAGTGCTTTGGG + Intergenic
1041257205 8:55989505-55989527 AAGGTCCAGGCAGGTGCATTTGG + Intronic
1041919657 8:63168168-63168190 CCGGGCCTAGCAGGAGCCTTCGG - Intergenic
1042498709 8:69485533-69485555 CTGGGGCTGGCAGGTGCATTAGG - Intronic
1045205090 8:100030409-100030431 CAGGCTCAGGCAGGTGCTTCAGG + Intronic
1047753095 8:127897255-127897277 CTGGGCCAGGTGGGTGCATTTGG + Intergenic
1048484150 8:134831968-134831990 CCGGGCCAGGTGAGTGCCTTGGG - Intergenic
1049194533 8:141308140-141308162 CCGGGCCGGGCAGGGGCTACGGG + Intronic
1049284511 8:141767277-141767299 CTGGGTCAGGCAGGTGGTCTAGG + Intergenic
1049655730 8:143796135-143796157 CCAGGACAGGCAGGGGCTTCTGG + Intronic
1050007819 9:1152354-1152376 CCTGGCCAGATAGGTGCTGTGGG - Intergenic
1053149149 9:35732042-35732064 CCGGGCCGGGCGGGGGCCTTAGG - Intronic
1056773872 9:89497861-89497883 CGGGGCCGGGCAGGTGCGCTGGG - Intronic
1056954744 9:91072967-91072989 CTGGGCCAGGAGAGTGCTTTGGG + Intergenic
1057388186 9:94622530-94622552 CCGGACCAGGCATGTGGGTTTGG - Intronic
1057536424 9:95912780-95912802 CCAGGCCAGTCAGTTGTTTTAGG + Intronic
1060797695 9:126523706-126523728 CAGAGCCAGGGAGATGCTTTGGG - Intergenic
1060798972 9:126531858-126531880 CCGGGGCAGGGATGTGGTTTGGG - Intergenic
1060919004 9:127407302-127407324 CTGGGGCAGGCAGGGGCTCTGGG - Exonic
1062038096 9:134391632-134391654 CAGGGCCAGGCAGGGGCTCCTGG - Intronic
1062112979 9:134792173-134792195 CCGGGGCAGCCAGCTGCTTTGGG + Intronic
1062265493 9:135684909-135684931 CGGGGCGAGGCAGGTGCTGTTGG + Intergenic
1062267466 9:135693838-135693860 GCAGGGCAGGCAGGTGCTCTGGG + Intronic
1062298964 9:135853307-135853329 CTGGGCCAAGCAGGTGCTCCTGG + Intronic
1185786859 X:2898239-2898261 CCGGGCCTGGGAGGGGCTTCAGG - Intergenic
1185877613 X:3713278-3713300 CCGGGCCAGGCCGGAGCGCTCGG + Exonic
1193699517 X:84744393-84744415 CCGGGCCTAGGAGGGGCTTTAGG - Intergenic
1197728421 X:129791631-129791653 CTCGTCCAGGCAGGGGCTTTGGG + Intronic
1200091581 X:153638565-153638587 CAGGCCCAGGCAGGGGCTTGTGG - Intergenic
1200787693 Y:7274266-7274288 CCGGGCCAGGCCGGAGCGCTCGG - Intergenic
1201287540 Y:12391967-12391989 CCGGGCCTGGGAGGGGCTTCAGG + Intergenic