ID: 901531072

View in Genome Browser
Species Human (GRCh38)
Location 1:9852847-9852869
Sequence ATTCCCTCCTGGGGCATCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 219}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901531072_901531083 18 Left 901531072 1:9852847-9852869 CCCTGGATGCCCCAGGAGGGAAT 0: 1
1: 0
2: 0
3: 17
4: 219
Right 901531083 1:9852888-9852910 ATGGGCCATTGGCTTCTCAGAGG 0: 1
1: 0
2: 2
3: 23
4: 127
901531072_901531078 -7 Left 901531072 1:9852847-9852869 CCCTGGATGCCCCAGGAGGGAAT 0: 1
1: 0
2: 0
3: 17
4: 219
Right 901531078 1:9852863-9852885 AGGGAATGGTGCATCTACAGAGG 0: 1
1: 0
2: 2
3: 12
4: 132
901531072_901531082 7 Left 901531072 1:9852847-9852869 CCCTGGATGCCCCAGGAGGGAAT 0: 1
1: 0
2: 0
3: 17
4: 219
Right 901531082 1:9852877-9852899 CTACAGAGGGAATGGGCCATTGG 0: 1
1: 1
2: 3
3: 14
4: 141
901531072_901531079 -6 Left 901531072 1:9852847-9852869 CCCTGGATGCCCCAGGAGGGAAT 0: 1
1: 0
2: 0
3: 17
4: 219
Right 901531079 1:9852864-9852886 GGGAATGGTGCATCTACAGAGGG 0: 1
1: 0
2: 0
3: 4
4: 128
901531072_901531081 0 Left 901531072 1:9852847-9852869 CCCTGGATGCCCCAGGAGGGAAT 0: 1
1: 0
2: 0
3: 17
4: 219
Right 901531081 1:9852870-9852892 GGTGCATCTACAGAGGGAATGGG 0: 1
1: 0
2: 0
3: 11
4: 111
901531072_901531080 -1 Left 901531072 1:9852847-9852869 CCCTGGATGCCCCAGGAGGGAAT 0: 1
1: 0
2: 0
3: 17
4: 219
Right 901531080 1:9852869-9852891 TGGTGCATCTACAGAGGGAATGG 0: 1
1: 0
2: 2
3: 24
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901531072 Original CRISPR ATTCCCTCCTGGGGCATCCA GGG (reversed) Intronic