ID: 901531072

View in Genome Browser
Species Human (GRCh38)
Location 1:9852847-9852869
Sequence ATTCCCTCCTGGGGCATCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 219}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901531072_901531080 -1 Left 901531072 1:9852847-9852869 CCCTGGATGCCCCAGGAGGGAAT 0: 1
1: 0
2: 0
3: 17
4: 219
Right 901531080 1:9852869-9852891 TGGTGCATCTACAGAGGGAATGG 0: 1
1: 0
2: 2
3: 24
4: 216
901531072_901531081 0 Left 901531072 1:9852847-9852869 CCCTGGATGCCCCAGGAGGGAAT 0: 1
1: 0
2: 0
3: 17
4: 219
Right 901531081 1:9852870-9852892 GGTGCATCTACAGAGGGAATGGG 0: 1
1: 0
2: 0
3: 11
4: 111
901531072_901531079 -6 Left 901531072 1:9852847-9852869 CCCTGGATGCCCCAGGAGGGAAT 0: 1
1: 0
2: 0
3: 17
4: 219
Right 901531079 1:9852864-9852886 GGGAATGGTGCATCTACAGAGGG 0: 1
1: 0
2: 0
3: 4
4: 128
901531072_901531082 7 Left 901531072 1:9852847-9852869 CCCTGGATGCCCCAGGAGGGAAT 0: 1
1: 0
2: 0
3: 17
4: 219
Right 901531082 1:9852877-9852899 CTACAGAGGGAATGGGCCATTGG 0: 1
1: 1
2: 3
3: 14
4: 141
901531072_901531078 -7 Left 901531072 1:9852847-9852869 CCCTGGATGCCCCAGGAGGGAAT 0: 1
1: 0
2: 0
3: 17
4: 219
Right 901531078 1:9852863-9852885 AGGGAATGGTGCATCTACAGAGG 0: 1
1: 0
2: 2
3: 12
4: 132
901531072_901531083 18 Left 901531072 1:9852847-9852869 CCCTGGATGCCCCAGGAGGGAAT 0: 1
1: 0
2: 0
3: 17
4: 219
Right 901531083 1:9852888-9852910 ATGGGCCATTGGCTTCTCAGAGG 0: 1
1: 0
2: 2
3: 23
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901531072 Original CRISPR ATTCCCTCCTGGGGCATCCA GGG (reversed) Intronic
900115127 1:1025060-1025082 AGTCCCTCCTGGGGGCTTCAGGG - Intronic
900361711 1:2292374-2292396 AGTCCTTCATGGGGCACCCAGGG - Intronic
900756994 1:4442916-4442938 ATTCCCTTGTGAGGCTTCCACGG + Intergenic
900792621 1:4690170-4690192 ATCCCCTCCTCGGGCCTCCTGGG - Intronic
901531072 1:9852847-9852869 ATTCCCTCCTGGGGCATCCAGGG - Intronic
902103225 1:14011147-14011169 ATTCCATCCTGGGACACCAAGGG - Intergenic
902136350 1:14309489-14309511 ATTCCTCCCTGTGGCCTCCAAGG - Intergenic
903572006 1:24312965-24312987 ATTCCTTCCTGGAGCTTCCTTGG - Intergenic
904756655 1:32771851-32771873 AGCCCCTCCTGGAGCACCCACGG - Exonic
906211029 1:44012285-44012307 ATTCCCACCTGGCCTATCCAAGG - Intronic
909056367 1:70825773-70825795 AGTTCCTTCTGGGGGATCCAGGG + Intergenic
909846664 1:80402419-80402441 AATCCCTCCTGTGGCAACCCTGG + Intergenic
910041091 1:82852183-82852205 AGTCACACCTGGGGCAGCCAAGG + Intergenic
911123410 1:94318502-94318524 ACTCCCTCATGGGGTAACCATGG - Intergenic
911331245 1:96528245-96528267 ATTCCCTCCTTGGGGTTTCAAGG + Intergenic
912572359 1:110633819-110633841 ATTCCCTCCTCAGCCATCAAAGG - Intergenic
912697403 1:111851836-111851858 AGTCTCTCCTGGAGAATCCAGGG - Intronic
915157759 1:153892393-153892415 ATTCCCTCCTATTGAATCCAAGG + Intronic
918050259 1:180967377-180967399 ATAGCCTCCTGGGGCATGGAAGG + Intergenic
919314050 1:195948580-195948602 AGTCCTTCCTGGGGCACCCGAGG + Intergenic
919650948 1:200148259-200148281 ATTCCCTCGGAGGGCAGCCATGG + Intronic
920833691 1:209488200-209488222 ATTCCCTTCTGGGGAATTCTGGG - Intergenic
922861230 1:228818431-228818453 GGTCCTTCCTGGGGCACCCAAGG - Intergenic
1062896767 10:1109187-1109209 AGTCCCTCCTGGTGCCTTCAAGG + Intronic
1062925105 10:1310504-1310526 TTTCACTTCTGGGGCCTCCAGGG - Intronic
1064308810 10:14193067-14193089 ATTCTACCCTGGGCCATCCATGG + Intronic
1068989226 10:63133688-63133710 TTGCCCTCCTGGGGGATCCCCGG + Intronic
1076176975 10:128375593-128375615 CTTCCCTCCTGGGGCCTTCAGGG - Intergenic
1076246325 10:128950208-128950230 CTGCCCTCCTGGTGCCTCCAGGG - Intergenic
1076627145 10:131829176-131829198 TCTCCCTCCTGAGGAATCCAGGG + Intergenic
1077480244 11:2811199-2811221 ATTCCCACCAGGGGCTTCCTGGG - Intronic
1077488269 11:2849016-2849038 CTTGGTTCCTGGGGCATCCATGG + Exonic
1079136159 11:17777009-17777031 TTTCCCTCCTGGGGGATTCCCGG - Intronic
1080322202 11:31023404-31023426 ATTCCATCCTGGGCAATCAAAGG + Intronic
1080986627 11:37474783-37474805 CTTCCCTCCTAAGGCATTCAAGG - Intergenic
1084183600 11:67458653-67458675 ATTCCCTCCTGGAGCCTCAGTGG - Exonic
1085540901 11:77268828-77268850 TTTCTCTCCAGGGGCTTCCATGG + Intronic
1085843152 11:80036983-80037005 ATTTCCTGCCGGGGCATCCATGG - Intergenic
1089703415 11:120259571-120259593 AGTCCCTCATGGGGCCTCCTGGG + Intronic
1091648356 12:2290694-2290716 AATCCCTCCTGCTGCCTCCAGGG + Intronic
1094566189 12:31600337-31600359 CTTCCCACCTGGGGCTTACATGG - Intergenic
1095092624 12:38121270-38121292 TTTCCCTCCTGGGACTGCCAGGG + Intergenic
1096104237 12:48987165-48987187 ATTCACTCCTGGGACCTCGATGG + Intergenic
1096752720 12:53772312-53772334 AATCCTTGCTGAGGCATCCAGGG + Intergenic
1098302064 12:69064437-69064459 CTTCCCTCCTGGGGCAGCCTTGG - Intergenic
1098708293 12:73719760-73719782 ATTCCCTTCTGGAGCCTCGAGGG - Intergenic
1099371015 12:81829807-81829829 ATTCCTCCCTGGTGCATCCAGGG - Intergenic
1100984059 12:100188248-100188270 ATTTCTTCCTGGTGCACCCAGGG + Intergenic
1101118193 12:101552542-101552564 ATTTTCTCCTGGGGCATCTGAGG - Intergenic
1101513289 12:105411740-105411762 AGTCCCTCCTGGTGCATCCTGGG - Intergenic
1102633485 12:114302266-114302288 GTTCCCTCCTGGTGCCTCCAGGG + Intergenic
1103148765 12:118618720-118618742 TTTCCCTTCTGGAGTATCCAAGG - Intergenic
1103447675 12:121004749-121004771 GTTGCCTCCTGGGACATCCCTGG - Intronic
1104765227 12:131325961-131325983 GTTCCCTCCTGGGTCTCCCATGG + Intergenic
1104765242 12:131326005-131326027 GTTCCCTCCTGGGTCTCCCATGG + Intergenic
1110737939 13:78960346-78960368 TTTCTCTCCTGAGGCATCCTGGG - Intergenic
1110838329 13:80110592-80110614 ATTCCTTCCTGGAGAATCTATGG - Intergenic
1112159241 13:96851151-96851173 TTTCCCTCCTGAGTCCTCCAAGG + Intergenic
1112365925 13:98755413-98755435 ATGCCCTCCAGGCTCATCCATGG + Intergenic
1113564970 13:111314339-111314361 AGAGCCTCCTGGAGCATCCATGG + Intergenic
1113601444 13:111572105-111572127 ATCCCTTCCTGGGGCCTCAAGGG + Intergenic
1115436262 14:33378287-33378309 ATTCCCTCCTGTTGCTTCTAGGG - Intronic
1118224239 14:63884119-63884141 TTTCCCTCCTGGAGTATCGAGGG + Intronic
1118774044 14:68962333-68962355 ATTCCCTTCCAGGGCATCCTTGG + Intronic
1119676896 14:76562570-76562592 CTTCTCTCCTGGGGCCTCTATGG - Intergenic
1120047447 14:79823912-79823934 ATTACCACCTGGTGTATCCATGG - Intronic
1121881282 14:97502724-97502746 ATCCACACCTGGGTCATCCAAGG - Intergenic
1125464507 15:39937217-39937239 ATACACTACTGGGGGATCCAGGG - Intronic
1128705431 15:69834625-69834647 ACTTCCTCCTAGGCCATCCAAGG - Intergenic
1129252706 15:74317773-74317795 ACCCCCTCCTGGGGCATGGAGGG - Intronic
1131505355 15:93013303-93013325 ATTCCCTCCTGGGGCCTTTCCGG - Intronic
1133213311 16:4274861-4274883 CTTCCCACCAGGGCCATCCATGG - Intergenic
1134482817 16:14633308-14633330 ACTCCCTCCTGGGGCTCCCTAGG + Intronic
1138332050 16:56223152-56223174 GTTCCCTTCTGGGGCTTCTAGGG + Intronic
1138798337 16:59996265-59996287 AGTCCATCTTGGGGAATCCAGGG + Intergenic
1140411563 16:74744048-74744070 ATTCCCACCTGGGGCACGCCAGG + Intronic
1141425773 16:83943538-83943560 TGGCCCTCCTGGGGAATCCAGGG - Intronic
1141471947 16:84244756-84244778 GTTCCCTCCTGGAGGCTCCAGGG - Intergenic
1142246494 16:88972553-88972575 AATCCCTCCTGGGTCAGTCATGG - Intronic
1144929885 17:18850856-18850878 TTTGCTTCCTGGGGCCTCCAGGG - Intronic
1145160127 17:20568449-20568471 AGTCCCACCTGGGGCTTCCCTGG + Intergenic
1146484148 17:33229834-33229856 ACTCCCTCCAGGAGCAGCCAGGG - Intronic
1146571164 17:33954442-33954464 AATCCCACCTGGGGCATCCCGGG + Intronic
1147718465 17:42523168-42523190 CCTCCCTCCAGGGGCCTCCAGGG + Intergenic
1148053815 17:44781812-44781834 ATCACATCCTGGGGCTTCCAGGG + Exonic
1148628060 17:49085429-49085451 ATTCTCTGCTGGGTCATCCTGGG + Intergenic
1148874624 17:50679667-50679689 AGGCCCACCTGGGTCATCCATGG + Intronic
1149454135 17:56773726-56773748 TTTTCCTCCTCTGGCATCCAGGG - Intergenic
1149491987 17:57091624-57091646 ATTGCCTGCTGGGGCAACAAGGG - Intronic
1151140233 17:71984546-71984568 CTTCCCTGCTATGGCATCCATGG + Intergenic
1151993870 17:77596441-77596463 AGTTCCTCCTGGAGCAGCCAGGG - Intergenic
1152135487 17:78500879-78500901 TTTCCCACCTGTGGCATTCAGGG + Intronic
1152398262 17:80048506-80048528 ATTCTATTCTGGGGCATCAATGG - Intronic
1153012821 18:555360-555382 AGTCCCTCCCTGGGCATTCAAGG + Intergenic
1155938703 18:31781467-31781489 TCTCCCTCCTGGGGCATCAGAGG - Intergenic
1160131952 18:76233251-76233273 TTCGCCTCCTGGGGCCTCCATGG + Intergenic
1160705168 19:526171-526193 GGTCCCTCCTGGGGGCTCCAGGG + Intergenic
1161031718 19:2060833-2060855 GGTCCCTCCTGGGGGCTCCAGGG - Intergenic
1161140005 19:2641575-2641597 AGTCCCTCCTTGGGGCTCCAGGG - Intronic
1161296395 19:3522680-3522702 CCTCCCTCCTGGGGCCTCCAGGG + Intronic
1161632423 19:5364925-5364947 GGTCCCTCCTGGGGCAACCTGGG - Intergenic
1162356538 19:10188947-10188969 ATTCCTTTCTGGGGGCTCCAGGG - Intronic
1164632672 19:29771894-29771916 ATTCCTCCCTGGAGCCTCCAGGG + Intergenic
1165087401 19:33360749-33360771 CTTCCCTCCTGAGGGATCCCAGG - Intergenic
1165263173 19:34637983-34638005 TTTCCTTGCTGGGGCATCCCTGG + Intronic
1166034254 19:40155906-40155928 ATTCCTTCCTGTGGCAACCACGG - Intergenic
1166283863 19:41811612-41811634 ATTCTCTCCTGGGTCACACAAGG + Intergenic
1167233154 19:48297783-48297805 CTTCCCTTCTGGGGCACCCGGGG + Intronic
1168206462 19:54853762-54853784 CTTCCCTCCTGGCCCACCCAGGG + Exonic
1168661599 19:58171782-58171804 ATTCTCTCCTGGAGCCTCCAAGG - Intergenic
926919789 2:17929163-17929185 ATTCCCACCAGAGGCATCGAAGG - Intronic
927217259 2:20674879-20674901 ACTCCCTCCTGTTCCATCCACGG - Intergenic
927249195 2:20982792-20982814 ATTCCCTTCTGGGGGATGCTGGG + Intergenic
931642259 2:64392305-64392327 CTTTCCTCCAGGGGCATCTATGG - Intergenic
933765537 2:85706146-85706168 CTTCCATCCTGTGGCAGCCATGG - Intergenic
935356661 2:102207727-102207749 ATTCCCATCTAGGGCAGCCAAGG - Intronic
937284321 2:120740816-120740838 ATTCCCTCTTTGGGCAGCCGAGG + Intronic
939417296 2:141916273-141916295 ATGGCCTTCTGGTGCATCCATGG - Intronic
939960008 2:148558244-148558266 ATTCTCTCCTCAGGCCTCCAGGG - Intergenic
940377531 2:152972383-152972405 ATGCCCTTCTAGGACATCCAGGG - Intergenic
942838397 2:180329332-180329354 ATCACCACCTGGGGCAGCCAAGG + Intergenic
943107085 2:183559206-183559228 AATCCTTCCAGTGGCATCCAAGG - Intergenic
943346449 2:186743846-186743868 ATTTCTTACTGGGGCTTCCATGG + Intronic
944892405 2:204131043-204131065 CTTCCTTCCTCAGGCATCCAGGG - Intergenic
945019505 2:205557006-205557028 ATTCCCACCTGGCCCATCCCTGG + Intronic
946740904 2:222800293-222800315 AATCCCTGCTTGGGCTTCCAGGG - Intergenic
947705659 2:232273541-232273563 ATTATTTGCTGGGGCATCCAGGG + Intronic
948062029 2:235049186-235049208 ACTCCATCCAGGGGCAGCCAAGG - Intronic
948406429 2:237723745-237723767 TCTTCCTCCTGGGGCCTCCAGGG + Intronic
1171148630 20:22807495-22807517 ATTTTCTCCTGGAGCCTCCAGGG - Intergenic
1172033467 20:31996732-31996754 ATGACCTTCTGGGTCATCCAAGG + Exonic
1172275528 20:33677005-33677027 CCTCCCTGCTGGGGCATCCCCGG - Intronic
1172612750 20:36263984-36264006 ATCCCCTCCTTGGACATCAAGGG + Intronic
1172962917 20:38811179-38811201 ATTCCTTCCTGGGGCCACCGTGG - Intronic
1174444759 20:50583030-50583052 GCTCCCTCCTGGAGCATCCCAGG + Exonic
1174659128 20:52195345-52195367 ATGCCCTCCTGGAGCTTACATGG - Intronic
1176140652 20:63543306-63543328 AGGCCCACCTGGGGCATGCAGGG + Exonic
1176162912 20:63657697-63657719 ACTCCCTCCTGGGGCCTTCTGGG + Intergenic
1179805132 21:43832566-43832588 GTGCCCTCCTCGGACATCCAAGG + Intergenic
1180500183 22:15923285-15923307 ATTCCATCCTGCGGGATCCCAGG - Intergenic
1180929465 22:19579160-19579182 ACTCCCTCCTGGGGTCTCAAGGG + Intergenic
1181597786 22:23928384-23928406 ATGCCCTCCTACGGCATACATGG - Intergenic
1181863509 22:25837384-25837406 AATCCCTCCTGTGGCTTCCAGGG - Intronic
1181886366 22:26025207-26025229 ATTCCCTCCCGTGCCTTCCATGG + Intronic
1182428030 22:30285183-30285205 TCTCCCTCCTGGGGCCTCCAAGG - Exonic
1182566746 22:31205818-31205840 CTTCCCTCCTGTGGAATCGAGGG + Exonic
1183946568 22:41329642-41329664 ATTCCCTCCTGGAGAAGCCTAGG + Intronic
1183950300 22:41348969-41348991 CTGCCCTCCTGTGTCATCCATGG + Intronic
1184284590 22:43462731-43462753 CTTACCTCCTGGAGCCTCCAAGG + Intronic
1184337919 22:43865766-43865788 ATTCCTTTCTGGAGGATCCAGGG + Intergenic
1184411271 22:44327775-44327797 ATGCCCTCCTGGGGACACCAGGG - Intergenic
1184934841 22:47713793-47713815 GTTCACTCCTGGGGTCTCCATGG + Intergenic
949344491 3:3064244-3064266 ATTCTATCCTGGGGGATCAATGG - Intergenic
949924617 3:9031398-9031420 CTTCCTTCCTGATGCATCCATGG + Intronic
950304021 3:11904657-11904679 AGTCCCACCTTGGGCAGCCAAGG - Intergenic
950505859 3:13394107-13394129 AGTCCCACCTTGGGCAGCCAAGG + Intronic
950664290 3:14485907-14485929 AGTCCTTCCTGGGGCATTCCAGG + Exonic
953202621 3:40790972-40790994 ACTCCCTGCTGGGTCATCAAAGG - Intergenic
954465959 3:50654921-50654943 AATCCTTCCTCTGGCATCCAGGG - Intergenic
954768458 3:52943348-52943370 ATTACCTTCTGGGGCTTCAAGGG + Exonic
955083595 3:55680423-55680445 AATGCCTCTTGGGGGATCCATGG + Intronic
960577740 3:119243991-119244013 ATTTCCTGCTGGGAAATCCATGG - Intergenic
961036137 3:123643101-123643123 TTTCCCTCACTGGGCATCCATGG + Intronic
961990183 3:131181359-131181381 CTTCCTTTCTGGGGGATCCAAGG - Intronic
962663310 3:137627298-137627320 AATTCCTCCTGGGGCATCTGAGG + Intergenic
963083836 3:141418470-141418492 CTTCACTGATGGGGCATCCAGGG - Intronic
963281035 3:143384795-143384817 TTTCCCTCCTGGGGAAGCCAGGG + Intronic
963914648 3:150847105-150847127 TTTCCCTCATGGGGCATTCCTGG - Intergenic
965057678 3:163743495-163743517 ATTCCCTACTGAGGCCTCCCTGG - Intergenic
966666535 3:182477994-182478016 ATTCTTTCCTAGGGCAGCCAAGG - Intergenic
966823935 3:183947638-183947660 ATACCCTCCTGGAGTTTCCAGGG - Intronic
967847648 3:194056972-194056994 CATACTTCCTGGGGCATCCAAGG + Intergenic
968126395 3:196163642-196163664 GTTCCCTCCTTGGGCACTCATGG - Intergenic
968688423 4:1976906-1976928 AATCCCTCCTGGAGGTTCCAGGG - Intronic
969156038 4:5210826-5210848 ATTCCAGCCTGGGGCATAGAGGG - Intronic
969547884 4:7843843-7843865 TCTCCCTTCTGGGGCATCCTTGG + Intronic
972397765 4:38672429-38672451 ATTGCTCCCTGGGGGATCCAAGG - Intronic
979558415 4:122076581-122076603 CTTCCCTCCTGTGGAATCGAGGG - Intergenic
979976571 4:127204061-127204083 ATTCCCTCCTGGGAAATGCCTGG - Intergenic
982831544 4:160067500-160067522 ATGACCTTCTGAGGCATCCAAGG - Intergenic
985051036 4:185991375-185991397 ATTCTCTCCTTGGGATTCCATGG - Intergenic
985834081 5:2257823-2257845 GTTCCCTCATGGGGAATTCAAGG - Intergenic
988809540 5:34770775-34770797 ATTCCTTCCTGTAGCATACAAGG - Intronic
993239384 5:85361084-85361106 ATTCCTTCCTGGAGAGTCCAAGG + Intergenic
994257279 5:97613767-97613789 ATTCCTTCCTGGGGGATCAGCGG + Intergenic
1000794757 5:165651059-165651081 AATCCCACCTAGGGGATCCATGG - Intergenic
1001002236 5:168018578-168018600 ATTCCTTCCTGGGACTTCCTGGG - Intronic
1005022805 6:21433796-21433818 ATTCCTTTCTGGAGCCTCCAGGG - Intergenic
1006807458 6:36797931-36797953 ATTTCCTCCTGGGCCTTCCCAGG + Intronic
1007211689 6:40197554-40197576 ACTCCCTCCTGGAGCTTCCTGGG - Intergenic
1007388506 6:41535943-41535965 AATCCAGCCTGGGGCATTCAGGG + Intergenic
1011551560 6:88535364-88535386 ATTCCCTCCTGGGGATTCCCAGG + Intergenic
1014179731 6:118371734-118371756 ATTCCATCCTGGCCCTTCCAGGG + Intergenic
1017252568 6:152297088-152297110 ATTCCTTCCTGTGGCATTCAGGG + Intronic
1017650856 6:156581372-156581394 ATTCCCTTCTGGAGACTCCAGGG + Intergenic
1018430684 6:163719390-163719412 ATTCCCTCCTTGGGTTTCCCAGG + Intergenic
1021034796 7:15784864-15784886 ATTCCCACCTGGGGTAGCTATGG + Intergenic
1024547749 7:50536580-50536602 ATTCACCCCTGGAGCCTCCAAGG + Intronic
1025104264 7:56157911-56157933 ATTCCCTCCTGAGGTAGGCAGGG - Intergenic
1026316517 7:69232328-69232350 ATTCCCTCCTGGGATAGGCAGGG + Intergenic
1027751679 7:82155593-82155615 GTTCCCTCCTGGAGCTTCCCAGG + Intronic
1029184212 7:98727071-98727093 TTTCCCTCTTGCTGCATCCAGGG - Intergenic
1029957963 7:104659451-104659473 ATGCCCTGCTGGGGCAGCCTTGG - Intronic
1030167403 7:106569186-106569208 ATTTCCTCCAGGGGCTTCAATGG - Intergenic
1032500253 7:132394698-132394720 ATTTCTTCCTGGGTCATTCATGG - Intronic
1032755747 7:134889227-134889249 ATTCCTTCCTGGAGGCTCCAGGG + Intronic
1034591534 7:152144141-152144163 ATTCCATTCTGAGACATCCAAGG + Intronic
1035280550 7:157775719-157775741 GGTACCTGCTGGGGCATCCAGGG + Intronic
1037824988 8:22155659-22155681 ATTGCCTCTTGGGGCACCCATGG + Intronic
1039101472 8:33946538-33946560 ATTCCCTTCTGGAGGCTCCAGGG + Intergenic
1039254698 8:35706341-35706363 CTTACCTCCTGTGGAATCCATGG + Intronic
1042051858 8:64718561-64718583 GTCCCCTTCTGGGGCATACATGG + Intronic
1043771492 8:84207419-84207441 ATGCCCTCCAGGTTCATCCATGG - Intronic
1044008863 8:86967184-86967206 GGTCCTTCCTGGGGCTTCCAAGG + Intronic
1048544766 8:135376607-135376629 ATTGCTTCCTGTGGCATTCAGGG + Intergenic
1048951661 8:139501615-139501637 CTTCCCTCGTGGGCCCTCCAGGG + Intergenic
1049029236 8:140022052-140022074 AGTCCCTCCTATGACATCCATGG - Intronic
1053221192 9:36314627-36314649 CTTCCCTCCTGTGGTAGCCAGGG - Intergenic
1056028247 9:82523979-82524001 ATTCCCTCCTAGAGCTTCTAGGG - Intergenic
1057183029 9:93040048-93040070 GATCCCTCCAGGGACATCCAGGG + Intergenic
1057208347 9:93186101-93186123 TATCCCTGCTGGGGCAGCCACGG - Intronic
1058324380 9:103677436-103677458 ATTCCTTCTTGGGGCACCAAGGG + Intergenic
1058941854 9:109820865-109820887 TTTCTGTCCTGGGGCAGCCATGG + Intronic
1060172038 9:121469803-121469825 ATTGCCTCCTGGGGTGTGCAGGG - Intergenic
1060402614 9:123357238-123357260 AATTCCTCCTGGGGGGTCCAAGG + Intronic
1060553105 9:124494965-124494987 CTTCTCTCCTGGGGCGTCCCTGG + Intronic
1061901109 9:133672551-133672573 ATCCCCACCTGGTGCAGCCAGGG - Intronic
1062161003 9:135079806-135079828 AACCCCACCAGGGGCATCCAGGG - Intronic
1186259283 X:7759074-7759096 ATTCCCACCAGCGGCATGCAAGG + Intergenic
1187698901 X:21946190-21946212 ATTGGCCCCTTGGGCATCCATGG + Intronic
1194205810 X:91009748-91009770 ATTCCAGCCTGGAGGATCCATGG - Intergenic
1194223630 X:91227473-91227495 ATTCCCTGCTGTGGCAGCTAAGG + Intergenic
1195815610 X:108883184-108883206 ATTTCTTCCTGGGGGCTCCAGGG + Intergenic
1199287853 X:146073824-146073846 ATTCCTTCCTGGGGACTCCAGGG - Intergenic
1199611002 X:149613541-149613563 ATTCCTTTCTGGAGCCTCCAGGG - Intronic
1200551568 Y:4584559-4584581 ATTCCAGCCTGGAGGATCCATGG - Intergenic
1200560096 Y:4690855-4690877 ATTCCCTGCTGTGGCAGCTAAGG + Intergenic