ID: 901532661

View in Genome Browser
Species Human (GRCh38)
Location 1:9863422-9863444
Sequence GGCTTGGAGGCTTCTCTCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 155}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901532661_901532673 27 Left 901532661 1:9863422-9863444 CCTCTGAGAGAAGCCTCCAAGCC 0: 1
1: 0
2: 2
3: 16
4: 155
Right 901532673 1:9863472-9863494 ACCCCAGCAGATCATCCGTGTGG 0: 1
1: 0
2: 0
3: 5
4: 70
901532661_901532669 -4 Left 901532661 1:9863422-9863444 CCTCTGAGAGAAGCCTCCAAGCC 0: 1
1: 0
2: 2
3: 16
4: 155
Right 901532669 1:9863441-9863463 AGCCACATGCGGGGAGAGAGGGG 0: 1
1: 0
2: 1
3: 25
4: 225
901532661_901532668 -5 Left 901532661 1:9863422-9863444 CCTCTGAGAGAAGCCTCCAAGCC 0: 1
1: 0
2: 2
3: 16
4: 155
Right 901532668 1:9863440-9863462 AAGCCACATGCGGGGAGAGAGGG 0: 1
1: 0
2: 0
3: 13
4: 172
901532661_901532667 -6 Left 901532661 1:9863422-9863444 CCTCTGAGAGAAGCCTCCAAGCC 0: 1
1: 0
2: 2
3: 16
4: 155
Right 901532667 1:9863439-9863461 CAAGCCACATGCGGGGAGAGAGG 0: 1
1: 0
2: 0
3: 14
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901532661 Original CRISPR GGCTTGGAGGCTTCTCTCAG AGG (reversed) Intronic