ID: 901532665

View in Genome Browser
Species Human (GRCh38)
Location 1:9863435-9863457
Sequence TCTCCCCGCATGTGGCTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 86}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901532665_901532678 21 Left 901532665 1:9863435-9863457 CCTCCAAGCCACATGCGGGGAGA 0: 1
1: 0
2: 0
3: 8
4: 86
Right 901532678 1:9863479-9863501 CAGATCATCCGTGTGGCACCGGG 0: 1
1: 0
2: 1
3: 5
4: 67
901532665_901532673 14 Left 901532665 1:9863435-9863457 CCTCCAAGCCACATGCGGGGAGA 0: 1
1: 0
2: 0
3: 8
4: 86
Right 901532673 1:9863472-9863494 ACCCCAGCAGATCATCCGTGTGG 0: 1
1: 0
2: 0
3: 5
4: 70
901532665_901532677 20 Left 901532665 1:9863435-9863457 CCTCCAAGCCACATGCGGGGAGA 0: 1
1: 0
2: 0
3: 8
4: 86
Right 901532677 1:9863478-9863500 GCAGATCATCCGTGTGGCACCGG 0: 1
1: 0
2: 0
3: 2
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901532665 Original CRISPR TCTCCCCGCATGTGGCTTGG AGG (reversed) Intronic