ID: 901532666

View in Genome Browser
Species Human (GRCh38)
Location 1:9863438-9863460
Sequence CTCTCTCCCCGCATGTGGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 155}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901532666_901532680 30 Left 901532666 1:9863438-9863460 CCAAGCCACATGCGGGGAGAGAG 0: 1
1: 0
2: 1
3: 8
4: 155
Right 901532680 1:9863491-9863513 GTGGCACCGGGCCAGTGCAAAGG 0: 1
1: 0
2: 0
3: 8
4: 103
901532666_901532678 18 Left 901532666 1:9863438-9863460 CCAAGCCACATGCGGGGAGAGAG 0: 1
1: 0
2: 1
3: 8
4: 155
Right 901532678 1:9863479-9863501 CAGATCATCCGTGTGGCACCGGG 0: 1
1: 0
2: 1
3: 5
4: 67
901532666_901532677 17 Left 901532666 1:9863438-9863460 CCAAGCCACATGCGGGGAGAGAG 0: 1
1: 0
2: 1
3: 8
4: 155
Right 901532677 1:9863478-9863500 GCAGATCATCCGTGTGGCACCGG 0: 1
1: 0
2: 0
3: 2
4: 60
901532666_901532673 11 Left 901532666 1:9863438-9863460 CCAAGCCACATGCGGGGAGAGAG 0: 1
1: 0
2: 1
3: 8
4: 155
Right 901532673 1:9863472-9863494 ACCCCAGCAGATCATCCGTGTGG 0: 1
1: 0
2: 0
3: 5
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901532666 Original CRISPR CTCTCTCCCCGCATGTGGCT TGG (reversed) Intronic