ID: 901532670

View in Genome Browser
Species Human (GRCh38)
Location 1:9863443-9863465
Sequence GTCCCCTCTCTCCCCGCATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 163}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901532670_901532677 12 Left 901532670 1:9863443-9863465 CCACATGCGGGGAGAGAGGGGAC 0: 1
1: 0
2: 2
3: 12
4: 163
Right 901532677 1:9863478-9863500 GCAGATCATCCGTGTGGCACCGG 0: 1
1: 0
2: 0
3: 2
4: 60
901532670_901532681 28 Left 901532670 1:9863443-9863465 CCACATGCGGGGAGAGAGGGGAC 0: 1
1: 0
2: 2
3: 12
4: 163
Right 901532681 1:9863494-9863516 GCACCGGGCCAGTGCAAAGGAGG 0: 1
1: 0
2: 0
3: 6
4: 104
901532670_901532678 13 Left 901532670 1:9863443-9863465 CCACATGCGGGGAGAGAGGGGAC 0: 1
1: 0
2: 2
3: 12
4: 163
Right 901532678 1:9863479-9863501 CAGATCATCCGTGTGGCACCGGG 0: 1
1: 0
2: 1
3: 5
4: 67
901532670_901532682 29 Left 901532670 1:9863443-9863465 CCACATGCGGGGAGAGAGGGGAC 0: 1
1: 0
2: 2
3: 12
4: 163
Right 901532682 1:9863495-9863517 CACCGGGCCAGTGCAAAGGAGGG 0: 1
1: 0
2: 1
3: 6
4: 121
901532670_901532683 30 Left 901532670 1:9863443-9863465 CCACATGCGGGGAGAGAGGGGAC 0: 1
1: 0
2: 2
3: 12
4: 163
Right 901532683 1:9863496-9863518 ACCGGGCCAGTGCAAAGGAGGGG 0: 1
1: 0
2: 0
3: 7
4: 133
901532670_901532680 25 Left 901532670 1:9863443-9863465 CCACATGCGGGGAGAGAGGGGAC 0: 1
1: 0
2: 2
3: 12
4: 163
Right 901532680 1:9863491-9863513 GTGGCACCGGGCCAGTGCAAAGG 0: 1
1: 0
2: 0
3: 8
4: 103
901532670_901532673 6 Left 901532670 1:9863443-9863465 CCACATGCGGGGAGAGAGGGGAC 0: 1
1: 0
2: 2
3: 12
4: 163
Right 901532673 1:9863472-9863494 ACCCCAGCAGATCATCCGTGTGG 0: 1
1: 0
2: 0
3: 5
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901532670 Original CRISPR GTCCCCTCTCTCCCCGCATG TGG (reversed) Intronic