ID: 901532671

View in Genome Browser
Species Human (GRCh38)
Location 1:9863465-9863487
Sequence GATGATCTGCTGGGGTTTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 152}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901532671_901532682 7 Left 901532671 1:9863465-9863487 CCCAGAAACCCCAGCAGATCATC 0: 1
1: 0
2: 2
3: 13
4: 152
Right 901532682 1:9863495-9863517 CACCGGGCCAGTGCAAAGGAGGG 0: 1
1: 0
2: 1
3: 6
4: 121
901532671_901532681 6 Left 901532671 1:9863465-9863487 CCCAGAAACCCCAGCAGATCATC 0: 1
1: 0
2: 2
3: 13
4: 152
Right 901532681 1:9863494-9863516 GCACCGGGCCAGTGCAAAGGAGG 0: 1
1: 0
2: 0
3: 6
4: 104
901532671_901532686 17 Left 901532671 1:9863465-9863487 CCCAGAAACCCCAGCAGATCATC 0: 1
1: 0
2: 2
3: 13
4: 152
Right 901532686 1:9863505-9863527 GTGCAAAGGAGGGGCCCAGCCGG 0: 1
1: 0
2: 1
3: 21
4: 249
901532671_901532687 29 Left 901532671 1:9863465-9863487 CCCAGAAACCCCAGCAGATCATC 0: 1
1: 0
2: 2
3: 13
4: 152
Right 901532687 1:9863517-9863539 GGCCCAGCCGGCTGCCCCCAAGG 0: 1
1: 0
2: 2
3: 30
4: 332
901532671_901532680 3 Left 901532671 1:9863465-9863487 CCCAGAAACCCCAGCAGATCATC 0: 1
1: 0
2: 2
3: 13
4: 152
Right 901532680 1:9863491-9863513 GTGGCACCGGGCCAGTGCAAAGG 0: 1
1: 0
2: 0
3: 8
4: 103
901532671_901532678 -9 Left 901532671 1:9863465-9863487 CCCAGAAACCCCAGCAGATCATC 0: 1
1: 0
2: 2
3: 13
4: 152
Right 901532678 1:9863479-9863501 CAGATCATCCGTGTGGCACCGGG 0: 1
1: 0
2: 1
3: 5
4: 67
901532671_901532677 -10 Left 901532671 1:9863465-9863487 CCCAGAAACCCCAGCAGATCATC 0: 1
1: 0
2: 2
3: 13
4: 152
Right 901532677 1:9863478-9863500 GCAGATCATCCGTGTGGCACCGG 0: 1
1: 0
2: 0
3: 2
4: 60
901532671_901532683 8 Left 901532671 1:9863465-9863487 CCCAGAAACCCCAGCAGATCATC 0: 1
1: 0
2: 2
3: 13
4: 152
Right 901532683 1:9863496-9863518 ACCGGGCCAGTGCAAAGGAGGGG 0: 1
1: 0
2: 0
3: 7
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901532671 Original CRISPR GATGATCTGCTGGGGTTTCT GGG (reversed) Intronic