ID: 901532673

View in Genome Browser
Species Human (GRCh38)
Location 1:9863472-9863494
Sequence ACCCCAGCAGATCATCCGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 70}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901532661_901532673 27 Left 901532661 1:9863422-9863444 CCTCTGAGAGAAGCCTCCAAGCC 0: 1
1: 0
2: 2
3: 16
4: 155
Right 901532673 1:9863472-9863494 ACCCCAGCAGATCATCCGTGTGG 0: 1
1: 0
2: 0
3: 5
4: 70
901532665_901532673 14 Left 901532665 1:9863435-9863457 CCTCCAAGCCACATGCGGGGAGA 0: 1
1: 0
2: 0
3: 8
4: 86
Right 901532673 1:9863472-9863494 ACCCCAGCAGATCATCCGTGTGG 0: 1
1: 0
2: 0
3: 5
4: 70
901532670_901532673 6 Left 901532670 1:9863443-9863465 CCACATGCGGGGAGAGAGGGGAC 0: 1
1: 0
2: 2
3: 12
4: 163
Right 901532673 1:9863472-9863494 ACCCCAGCAGATCATCCGTGTGG 0: 1
1: 0
2: 0
3: 5
4: 70
901532666_901532673 11 Left 901532666 1:9863438-9863460 CCAAGCCACATGCGGGGAGAGAG 0: 1
1: 0
2: 1
3: 8
4: 155
Right 901532673 1:9863472-9863494 ACCCCAGCAGATCATCCGTGTGG 0: 1
1: 0
2: 0
3: 5
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901532673 Original CRISPR ACCCCAGCAGATCATCCGTG TGG Intronic