ID: 901532677

View in Genome Browser
Species Human (GRCh38)
Location 1:9863478-9863500
Sequence GCAGATCATCCGTGTGGCAC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 60}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901532665_901532677 20 Left 901532665 1:9863435-9863457 CCTCCAAGCCACATGCGGGGAGA 0: 1
1: 0
2: 0
3: 8
4: 86
Right 901532677 1:9863478-9863500 GCAGATCATCCGTGTGGCACCGG 0: 1
1: 0
2: 0
3: 2
4: 60
901532671_901532677 -10 Left 901532671 1:9863465-9863487 CCCAGAAACCCCAGCAGATCATC 0: 1
1: 0
2: 2
3: 13
4: 152
Right 901532677 1:9863478-9863500 GCAGATCATCCGTGTGGCACCGG 0: 1
1: 0
2: 0
3: 2
4: 60
901532670_901532677 12 Left 901532670 1:9863443-9863465 CCACATGCGGGGAGAGAGGGGAC 0: 1
1: 0
2: 2
3: 12
4: 163
Right 901532677 1:9863478-9863500 GCAGATCATCCGTGTGGCACCGG 0: 1
1: 0
2: 0
3: 2
4: 60
901532666_901532677 17 Left 901532666 1:9863438-9863460 CCAAGCCACATGCGGGGAGAGAG 0: 1
1: 0
2: 1
3: 8
4: 155
Right 901532677 1:9863478-9863500 GCAGATCATCCGTGTGGCACCGG 0: 1
1: 0
2: 0
3: 2
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901532677 Original CRISPR GCAGATCATCCGTGTGGCAC CGG Intronic