ID: 901532681

View in Genome Browser
Species Human (GRCh38)
Location 1:9863494-9863516
Sequence GCACCGGGCCAGTGCAAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 104}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901532676_901532681 -4 Left 901532676 1:9863475-9863497 CCAGCAGATCATCCGTGTGGCAC 0: 1
1: 0
2: 0
3: 5
4: 46
Right 901532681 1:9863494-9863516 GCACCGGGCCAGTGCAAAGGAGG 0: 1
1: 0
2: 0
3: 6
4: 104
901532671_901532681 6 Left 901532671 1:9863465-9863487 CCCAGAAACCCCAGCAGATCATC 0: 1
1: 0
2: 2
3: 13
4: 152
Right 901532681 1:9863494-9863516 GCACCGGGCCAGTGCAAAGGAGG 0: 1
1: 0
2: 0
3: 6
4: 104
901532675_901532681 -3 Left 901532675 1:9863474-9863496 CCCAGCAGATCATCCGTGTGGCA 0: 1
1: 0
2: 0
3: 11
4: 79
Right 901532681 1:9863494-9863516 GCACCGGGCCAGTGCAAAGGAGG 0: 1
1: 0
2: 0
3: 6
4: 104
901532670_901532681 28 Left 901532670 1:9863443-9863465 CCACATGCGGGGAGAGAGGGGAC 0: 1
1: 0
2: 2
3: 12
4: 163
Right 901532681 1:9863494-9863516 GCACCGGGCCAGTGCAAAGGAGG 0: 1
1: 0
2: 0
3: 6
4: 104
901532672_901532681 5 Left 901532672 1:9863466-9863488 CCAGAAACCCCAGCAGATCATCC 0: 1
1: 0
2: 1
3: 12
4: 136
Right 901532681 1:9863494-9863516 GCACCGGGCCAGTGCAAAGGAGG 0: 1
1: 0
2: 0
3: 6
4: 104
901532674_901532681 -2 Left 901532674 1:9863473-9863495 CCCCAGCAGATCATCCGTGTGGC 0: 1
1: 0
2: 0
3: 7
4: 82
Right 901532681 1:9863494-9863516 GCACCGGGCCAGTGCAAAGGAGG 0: 1
1: 0
2: 0
3: 6
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901532681 Original CRISPR GCACCGGGCCAGTGCAAAGG AGG Intronic