ID: 901532683

View in Genome Browser
Species Human (GRCh38)
Location 1:9863496-9863518
Sequence ACCGGGCCAGTGCAAAGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 133}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901532675_901532683 -1 Left 901532675 1:9863474-9863496 CCCAGCAGATCATCCGTGTGGCA 0: 1
1: 0
2: 0
3: 11
4: 79
Right 901532683 1:9863496-9863518 ACCGGGCCAGTGCAAAGGAGGGG 0: 1
1: 0
2: 0
3: 7
4: 133
901532671_901532683 8 Left 901532671 1:9863465-9863487 CCCAGAAACCCCAGCAGATCATC 0: 1
1: 0
2: 2
3: 13
4: 152
Right 901532683 1:9863496-9863518 ACCGGGCCAGTGCAAAGGAGGGG 0: 1
1: 0
2: 0
3: 7
4: 133
901532672_901532683 7 Left 901532672 1:9863466-9863488 CCAGAAACCCCAGCAGATCATCC 0: 1
1: 0
2: 1
3: 12
4: 136
Right 901532683 1:9863496-9863518 ACCGGGCCAGTGCAAAGGAGGGG 0: 1
1: 0
2: 0
3: 7
4: 133
901532674_901532683 0 Left 901532674 1:9863473-9863495 CCCCAGCAGATCATCCGTGTGGC 0: 1
1: 0
2: 0
3: 7
4: 82
Right 901532683 1:9863496-9863518 ACCGGGCCAGTGCAAAGGAGGGG 0: 1
1: 0
2: 0
3: 7
4: 133
901532670_901532683 30 Left 901532670 1:9863443-9863465 CCACATGCGGGGAGAGAGGGGAC 0: 1
1: 0
2: 2
3: 12
4: 163
Right 901532683 1:9863496-9863518 ACCGGGCCAGTGCAAAGGAGGGG 0: 1
1: 0
2: 0
3: 7
4: 133
901532676_901532683 -2 Left 901532676 1:9863475-9863497 CCAGCAGATCATCCGTGTGGCAC 0: 1
1: 0
2: 0
3: 5
4: 46
Right 901532683 1:9863496-9863518 ACCGGGCCAGTGCAAAGGAGGGG 0: 1
1: 0
2: 0
3: 7
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901532683 Original CRISPR ACCGGGCCAGTGCAAAGGAG GGG Intronic