ID: 901532686

View in Genome Browser
Species Human (GRCh38)
Location 1:9863505-9863527
Sequence GTGCAAAGGAGGGGCCCAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 272
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 249}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901532672_901532686 16 Left 901532672 1:9863466-9863488 CCAGAAACCCCAGCAGATCATCC 0: 1
1: 0
2: 1
3: 12
4: 136
Right 901532686 1:9863505-9863527 GTGCAAAGGAGGGGCCCAGCCGG 0: 1
1: 0
2: 1
3: 21
4: 249
901532674_901532686 9 Left 901532674 1:9863473-9863495 CCCCAGCAGATCATCCGTGTGGC 0: 1
1: 0
2: 0
3: 7
4: 82
Right 901532686 1:9863505-9863527 GTGCAAAGGAGGGGCCCAGCCGG 0: 1
1: 0
2: 1
3: 21
4: 249
901532675_901532686 8 Left 901532675 1:9863474-9863496 CCCAGCAGATCATCCGTGTGGCA 0: 1
1: 0
2: 0
3: 11
4: 79
Right 901532686 1:9863505-9863527 GTGCAAAGGAGGGGCCCAGCCGG 0: 1
1: 0
2: 1
3: 21
4: 249
901532671_901532686 17 Left 901532671 1:9863465-9863487 CCCAGAAACCCCAGCAGATCATC 0: 1
1: 0
2: 2
3: 13
4: 152
Right 901532686 1:9863505-9863527 GTGCAAAGGAGGGGCCCAGCCGG 0: 1
1: 0
2: 1
3: 21
4: 249
901532676_901532686 7 Left 901532676 1:9863475-9863497 CCAGCAGATCATCCGTGTGGCAC 0: 1
1: 0
2: 0
3: 5
4: 46
Right 901532686 1:9863505-9863527 GTGCAAAGGAGGGGCCCAGCCGG 0: 1
1: 0
2: 1
3: 21
4: 249
901532679_901532686 -5 Left 901532679 1:9863487-9863509 CCGTGTGGCACCGGGCCAGTGCA 0: 1
1: 0
2: 0
3: 7
4: 106
Right 901532686 1:9863505-9863527 GTGCAAAGGAGGGGCCCAGCCGG 0: 1
1: 0
2: 1
3: 21
4: 249

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901532686 Original CRISPR GTGCAAAGGAGGGGCCCAGC CGG Intronic