ID: 901532687

View in Genome Browser
Species Human (GRCh38)
Location 1:9863517-9863539
Sequence GGCCCAGCCGGCTGCCCCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 365
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 332}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901532675_901532687 20 Left 901532675 1:9863474-9863496 CCCAGCAGATCATCCGTGTGGCA 0: 1
1: 0
2: 0
3: 11
4: 79
Right 901532687 1:9863517-9863539 GGCCCAGCCGGCTGCCCCCAAGG 0: 1
1: 0
2: 2
3: 30
4: 332
901532672_901532687 28 Left 901532672 1:9863466-9863488 CCAGAAACCCCAGCAGATCATCC 0: 1
1: 0
2: 1
3: 12
4: 136
Right 901532687 1:9863517-9863539 GGCCCAGCCGGCTGCCCCCAAGG 0: 1
1: 0
2: 2
3: 30
4: 332
901532671_901532687 29 Left 901532671 1:9863465-9863487 CCCAGAAACCCCAGCAGATCATC 0: 1
1: 0
2: 2
3: 13
4: 152
Right 901532687 1:9863517-9863539 GGCCCAGCCGGCTGCCCCCAAGG 0: 1
1: 0
2: 2
3: 30
4: 332
901532685_901532687 -8 Left 901532685 1:9863502-9863524 CCAGTGCAAAGGAGGGGCCCAGC 0: 1
1: 0
2: 2
3: 26
4: 192
Right 901532687 1:9863517-9863539 GGCCCAGCCGGCTGCCCCCAAGG 0: 1
1: 0
2: 2
3: 30
4: 332
901532684_901532687 -3 Left 901532684 1:9863497-9863519 CCGGGCCAGTGCAAAGGAGGGGC 0: 1
1: 0
2: 2
3: 21
4: 193
Right 901532687 1:9863517-9863539 GGCCCAGCCGGCTGCCCCCAAGG 0: 1
1: 0
2: 2
3: 30
4: 332
901532674_901532687 21 Left 901532674 1:9863473-9863495 CCCCAGCAGATCATCCGTGTGGC 0: 1
1: 0
2: 0
3: 7
4: 82
Right 901532687 1:9863517-9863539 GGCCCAGCCGGCTGCCCCCAAGG 0: 1
1: 0
2: 2
3: 30
4: 332
901532676_901532687 19 Left 901532676 1:9863475-9863497 CCAGCAGATCATCCGTGTGGCAC 0: 1
1: 0
2: 0
3: 5
4: 46
Right 901532687 1:9863517-9863539 GGCCCAGCCGGCTGCCCCCAAGG 0: 1
1: 0
2: 2
3: 30
4: 332
901532679_901532687 7 Left 901532679 1:9863487-9863509 CCGTGTGGCACCGGGCCAGTGCA 0: 1
1: 0
2: 0
3: 7
4: 106
Right 901532687 1:9863517-9863539 GGCCCAGCCGGCTGCCCCCAAGG 0: 1
1: 0
2: 2
3: 30
4: 332

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901532687 Original CRISPR GGCCCAGCCGGCTGCCCCCA AGG Intronic