ID: 901540353

View in Genome Browser
Species Human (GRCh38)
Location 1:9911103-9911125
Sequence CTGTATTTGGAGAGGGTACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901540346_901540353 10 Left 901540346 1:9911070-9911092 CCCATGATTAAAATGTTTCTACA No data
Right 901540353 1:9911103-9911125 CTGTATTTGGAGAGGGTACAGGG No data
901540347_901540353 9 Left 901540347 1:9911071-9911093 CCATGATTAAAATGTTTCTACAG No data
Right 901540353 1:9911103-9911125 CTGTATTTGGAGAGGGTACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901540353 Original CRISPR CTGTATTTGGAGAGGGTACA GGG Intergenic
No off target data available for this crispr