ID: 901540353

View in Genome Browser
Species Human (GRCh38)
Location 1:9911103-9911125
Sequence CTGTATTTGGAGAGGGTACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 168}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901540347_901540353 9 Left 901540347 1:9911071-9911093 CCATGATTAAAATGTTTCTACAG 0: 1
1: 0
2: 1
3: 24
4: 355
Right 901540353 1:9911103-9911125 CTGTATTTGGAGAGGGTACAGGG 0: 1
1: 0
2: 0
3: 11
4: 168
901540346_901540353 10 Left 901540346 1:9911070-9911092 CCCATGATTAAAATGTTTCTACA 0: 1
1: 0
2: 2
3: 30
4: 343
Right 901540353 1:9911103-9911125 CTGTATTTGGAGAGGGTACAGGG 0: 1
1: 0
2: 0
3: 11
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901540353 Original CRISPR CTGTATTTGGAGAGGGTACA GGG Intergenic
901280387 1:8029239-8029261 CTGTCTTTGGAGTGAGAACAAGG + Intergenic
901540353 1:9911103-9911125 CTGTATTTGGAGAGGGTACAGGG + Intergenic
902725020 1:18329748-18329770 TTGGATTGGGAGTGGGTACACGG - Intronic
905877996 1:41445633-41445655 ATGTATCTGGAGTGGGTAAAAGG + Intergenic
906355455 1:45102867-45102889 ATTTATTTGGTGGGGGTACAGGG + Intronic
909927666 1:81457780-81457802 CTCCATTTGGAGAGTGTAAAAGG - Intronic
910306484 1:85769987-85770009 CAGTACTTGGAGAGGATACTGGG + Intronic
913073780 1:115324069-115324091 CATTATTTTGAGATGGTACAAGG + Intronic
915146716 1:153799942-153799964 CTGGATCTGGAGAGGGTCCAGGG + Intergenic
915630444 1:157150165-157150187 CAGTTTTTTGAGTGGGTACAAGG + Intergenic
916503015 1:165402484-165402506 CTGTTTGGGGAGAGGATACATGG + Intronic
917820906 1:178763013-178763035 TTGTATTTGTATATGGTACAAGG + Intronic
919195414 1:194278661-194278683 TTGTAGGTGCAGAGGGTACATGG - Intergenic
919894446 1:202000440-202000462 CTGAATTTGGAGAGAGGACCCGG - Intronic
922184269 1:223260111-223260133 CTGCATTTAGAAAGGGTAGAAGG - Intronic
924022153 1:239795540-239795562 ATGTATTTGGACAGTTTACAAGG - Intronic
1062827354 10:582315-582337 CTGTATTTGGGTTGGGTGCATGG - Intronic
1063059504 10:2536802-2536824 CTGTATTTTTAGTGGGGACAGGG - Intergenic
1063086202 10:2820212-2820234 CTTTATTTGGGAAGTGTACACGG + Intergenic
1063255093 10:4319024-4319046 CTGTAATTGGAGCGGATTCAAGG - Intergenic
1065225843 10:23543086-23543108 TTGTCTTTGGAGAGGGGACCTGG - Intergenic
1066502003 10:36003605-36003627 GAGTGTTTGGAGAGGGGACAGGG - Intergenic
1066633294 10:37477801-37477823 CTTTGTTTGGGGAGGGTAGACGG - Intergenic
1068672525 10:59738353-59738375 CTCTATTTGGAGAGAGTTGAAGG - Intergenic
1079711082 11:23682528-23682550 CTGTATATTGAGATGATACATGG + Intergenic
1080899101 11:36470635-36470657 CTGGAGTGGGTGAGGGTACAAGG + Intergenic
1083147680 11:60771268-60771290 CTGTATGGGGAGAGGGGACCAGG - Intronic
1083868415 11:65471469-65471491 CTGTATTTGGAGAGGCTGAAGGG + Intergenic
1084343580 11:68527012-68527034 GTGTATTTGGAGTTAGTACAGGG + Intronic
1084421889 11:69064396-69064418 CTGCAGTCAGAGAGGGTACAGGG - Intronic
1085815555 11:79733505-79733527 GTGTATTTGGAGAAACTACAAGG + Intergenic
1088026535 11:105191119-105191141 TTGTATTTAGGTAGGGTACAAGG - Intergenic
1091179557 11:133591407-133591429 CTGTATGTGGTCAGGGTCCAGGG - Intergenic
1095992216 12:48043097-48043119 CTGTATTTGGACCAGGTCCAGGG + Exonic
1099602623 12:84760818-84760840 CTACATTTGGAAAGGGTACATGG + Intergenic
1105213656 13:18272365-18272387 CTGTGTGTGGGGAGGGCACAGGG - Intergenic
1105645203 13:22310809-22310831 CTATATTTGGAGAGGGTAGGAGG + Intergenic
1106713550 13:32364514-32364536 CTGTATTAGTAGAGGGAAGATGG - Intronic
1107958070 13:45536108-45536130 CTCTATTTTGAGAAGGTAGAAGG + Exonic
1110337451 13:74348119-74348141 CTGAACTTGGAGATGGTAGAAGG + Intergenic
1113202545 13:107883071-107883093 CTGTATTTGTAGAGGGGAGAGGG - Intergenic
1116360272 14:43986130-43986152 CTGTAAGGGGAGAGGGTATAAGG - Intergenic
1116467907 14:45254310-45254332 CTGGAGTTGGACAGGGTTCAGGG - Intergenic
1119689286 14:76658209-76658231 CTGTCTGTGGAGAGAGTAGAAGG + Intergenic
1119718389 14:76874689-76874711 CTGTATTTGGAGTGGCTATCTGG - Intergenic
1122488777 14:102099008-102099030 CTAACTTTGGAGAAGGTACAGGG - Intronic
1122774583 14:104111617-104111639 CAGCCTTTGGAGAGGGTGCAGGG - Intronic
1125069466 15:35534446-35534468 CTGTATTTTAAGAGGATATAGGG + Intronic
1125901659 15:43353780-43353802 CTGTACCTGAAGAGGGTAGAGGG + Exonic
1127221231 15:56883848-56883870 CTGAATTGGGAGAGGGTGAAAGG - Intronic
1127549554 15:60023384-60023406 CTGGATGGGGAGAGGGAACAGGG + Intronic
1128153352 15:65377189-65377211 CTGCATTTGGAGCTGGTACTGGG - Intronic
1129677740 15:77641605-77641627 CTGTAATTGGGGAGGGTGTAGGG - Intronic
1129785853 15:78309580-78309602 CTATGTGTGGAGAGGGGACAGGG + Intergenic
1132487868 16:205509-205531 CTGTCTGAGGAGAGGGTACATGG + Intronic
1132762703 16:1518677-1518699 GTGCATGTGGACAGGGTACACGG + Intronic
1138361295 16:56430598-56430620 CAGTATTAGAAGAGGGTATAAGG - Exonic
1139080393 16:63511482-63511504 CTGCATTTGCAGAGGGTTCTAGG + Intergenic
1142231094 16:88900643-88900665 CTGCATGTGGAGGTGGTACATGG + Intronic
1142676293 17:1515586-1515608 CTGGAATGGCAGAGGGTACAGGG + Intronic
1144744857 17:17607265-17607287 CTGGAGTTGGGGTGGGTACAGGG - Intergenic
1146608557 17:34284792-34284814 CCCTAGTTGGAGAGGGTATAAGG - Intergenic
1148244758 17:46023460-46023482 CTGTCTCTGGGGAGGGTACCTGG + Intronic
1148516857 17:48227163-48227185 CTGTGAATGGAGAGGGAACATGG + Intronic
1149140544 17:53428245-53428267 CTGTGATGGGAGAGGGTGCAAGG - Intergenic
1152036153 17:77874368-77874390 CTGTGTTTGGTGATGGTGCAGGG - Intergenic
1154355847 18:13622720-13622742 CTGTGTTTTGAGAGAGGACAGGG + Intronic
1155837156 18:30600273-30600295 CCATATTTCGAAAGGGTACAAGG - Intergenic
1168650342 19:58088400-58088422 CTTTATTTTCAGAGGGTTCATGG + Intronic
925422082 2:3720536-3720558 CTGCATGTGGGAAGGGTACATGG - Intronic
925769627 2:7269336-7269358 CTGTATTTGCAGAAGCTACTAGG - Intergenic
929560106 2:42951165-42951187 CTGGAGTTGGAGAAGGCACAGGG + Intergenic
930547029 2:52781263-52781285 TTGAATTTGGTGAGGTTACAAGG - Intergenic
933003357 2:76955737-76955759 CTCCACTTGGGGAGGGTACAAGG + Intronic
934300672 2:91774381-91774403 CTGTGTGTGGGGAGGGCACAGGG + Intergenic
936255746 2:110909298-110909320 GTGTATTTGGTGGGGGTACAGGG + Intronic
937108387 2:119341006-119341028 ATGGAATTGGGGAGGGTACATGG - Intronic
939800857 2:146706056-146706078 TTGTATATGGTGAGAGTACAGGG - Intergenic
940379226 2:152995239-152995261 CTGTATTTGGAGATCCTATAAGG - Intergenic
941548700 2:166887395-166887417 TGGTATTTGGAGACGATACAGGG - Intergenic
943531396 2:189085826-189085848 CTGTATATTGACAGAGTACAGGG - Intronic
945596022 2:211793944-211793966 TTGTATTGGGAGCGGGTAGAGGG + Intronic
945948286 2:216014824-216014846 TTGCATTTGGCGAGGGTATAGGG - Intronic
946166024 2:217864250-217864272 CTGAATGGGGAGAGGGTATATGG + Intronic
948132971 2:235614439-235614461 ATGTATTTGGGGAGGGAAGAAGG + Intronic
1169138749 20:3214242-3214264 CTGTAAGTGGAGATGGTAAAGGG + Intronic
1169339268 20:4783787-4783809 CTGTGTTTAGAGAGGGAAGAGGG - Exonic
1169772058 20:9211841-9211863 CTGTATTTTAAGATGGTACATGG + Intronic
1169789478 20:9393903-9393925 CAGAATTTGGAGAGGGCCCAAGG + Intronic
1178137698 21:29646361-29646383 CTCTATTGGGAGAGGATACTTGG + Intronic
1179439083 21:41380660-41380682 CTGCATTTGGAGGGGGTGCTGGG - Intronic
1179977561 21:44877748-44877770 CTGTTTTTAGAGAGCGTATAAGG - Intergenic
1180755307 22:18156948-18156970 CTGGGTTGGGGGAGGGTACACGG + Intronic
1181699027 22:24609517-24609539 CTGTGTGTGGGGAGGGCACAGGG + Intronic
1182084419 22:27551460-27551482 CTGTATTTGGAGATAATTCAGGG + Intergenic
1184035584 22:41916354-41916376 CTGTCTTTGGCCAGGGCACAAGG - Intergenic
1184633198 22:45802609-45802631 CTGCATTAGGAAAGGATACAAGG - Intronic
1185242970 22:49756272-49756294 CTGCACTTGGAGGGGGAACAAGG - Intergenic
950494360 3:13324726-13324748 CTGTGTTTGCAGAGGTTACCTGG - Intronic
950598566 3:14009277-14009299 CTGTAATAGGAGATGGAACACGG - Intronic
950797749 3:15524087-15524109 CTGTATGTGCAGAGGCTCCAAGG - Intergenic
951274219 3:20665481-20665503 CTTTATTTTGAGAGTCTACAGGG + Intergenic
953610248 3:44441784-44441806 ATGGATTTGGGGAGGGTACATGG - Exonic
956773938 3:72549701-72549723 CAGCATTTGGAGAGGGTCCCGGG + Intergenic
958729699 3:97948723-97948745 GTGATTTTGGAGAGGGTTCAAGG - Intronic
959546056 3:107598016-107598038 CAGTTTTAGGAGAGGGTACTTGG + Intronic
959589741 3:108065342-108065364 CTGGATTTGGAAAGGGTCAAGGG + Intronic
960294385 3:115925164-115925186 CTATTTTTGGAGAGTGTAGAGGG + Intronic
960927126 3:122805479-122805501 CTCTTTTTGCAGAGGGTACATGG - Intronic
963275300 3:143324144-143324166 CTCTATTGGGAGGGGGTAGAGGG + Intronic
964918780 3:161870601-161870623 CTGTATTAGGATAAGGTAGAAGG - Intergenic
969954094 4:10870465-10870487 GTGAATTTGGAGAGGGTAGCAGG + Intergenic
973263751 4:48189858-48189880 CTATTTTTGGAGAGGTAACATGG - Intronic
976878212 4:89883913-89883935 TTGGATTTGGAGTGGGTTCAAGG + Intronic
979641986 4:123019413-123019435 TTGCATTTGGAGAGGCTAGAAGG + Intronic
980184465 4:129444875-129444897 CATCATTTGGAGAAGGTACAAGG + Intergenic
985189788 4:187360316-187360338 TTGTATTTGGGGAGGGAAGAAGG + Intergenic
988423307 5:31032929-31032951 CAGCATTTGCAGAGGTTACATGG - Intergenic
991633111 5:68676914-68676936 ATATTTTTGGAGAGGGTACCTGG + Intergenic
993281668 5:85933115-85933137 TTGTATTTGGAAATGGTTCAAGG + Intergenic
993453617 5:88101877-88101899 TGGTATTTCAAGAGGGTACAAGG + Intergenic
996188670 5:120512173-120512195 CTGTATCTGGAGGGGAAACAAGG - Intronic
998042600 5:138961904-138961926 CTGTGTTTGGAGAAGCTAAAAGG - Intronic
998207051 5:140165442-140165464 ATATATTTGGGGAGTGTACAGGG + Intergenic
1000264209 5:159619362-159619384 CTCACTTTGGAGAGGATACATGG + Intergenic
1000908897 5:166996911-166996933 GTATATTTGGAGAGGGGAAAGGG - Intergenic
1001203364 5:169739301-169739323 CTGTAATTGTAGAGGGAAAATGG + Intronic
1006884819 6:37372596-37372618 CTGTCTCAGGAGAGGGTGCAGGG - Intronic
1010022915 6:71181886-71181908 CTATATCTGGGGAGGATACAAGG - Intergenic
1010531886 6:76978457-76978479 CTGAATTTGGTGAGGGTCCCAGG - Intergenic
1010579092 6:77572066-77572088 CTGAATTCGGGGAGTGTACATGG - Intergenic
1011722422 6:90171476-90171498 TTGGATTTGGAAAGGGCACATGG - Intronic
1012385848 6:98681469-98681491 GTGTATGTGGATAGTGTACATGG + Intergenic
1015611797 6:135030114-135030136 CTGTATTTGTAGAACTTACATGG + Intronic
1015765737 6:136714210-136714232 CTGTATTTGGAGAATCTACTCGG - Intronic
1016630539 6:146224957-146224979 CTGTATTTGGGGTGGGGAGAAGG - Intronic
1017368361 6:153672410-153672432 CTGTGTATGGACATGGTACATGG - Intergenic
1017700759 6:157067838-157067860 ATGTAATTGCAGAGTGTACATGG + Intronic
1018097782 6:160407154-160407176 GTGTATTTGGAAAGGGGACGTGG + Exonic
1018208480 6:161457456-161457478 CTGTATTCTGAAAGGATACATGG + Intronic
1018404001 6:163457644-163457666 TTTTTTTTGGAGAGGGGACAGGG + Intronic
1018549716 6:164981782-164981804 CTGTGTTTGTACAGGGTAGAAGG - Intergenic
1019065459 6:169292335-169292357 CTGTGCTTGGAGTGGGGACAAGG + Intergenic
1019303159 7:319320-319342 CTATTTTTGGCGAGGGCACATGG + Intergenic
1022495354 7:30849882-30849904 CTGTGTTTTGAGTGGGCACATGG - Intronic
1023349817 7:39309201-39309223 CAGGACTTGGAGAGGGTCCAAGG + Intronic
1026082033 7:67230483-67230505 TTGTGTTTGAGGAGGGTACAAGG - Intronic
1026695033 7:72583506-72583528 TTGTGTTTGAGGAGGGTACAAGG + Intronic
1031473570 7:122195905-122195927 CTGCACCTGGAGAGGGCACAGGG - Intergenic
1033292329 7:140097324-140097346 CTGATTTTGGAAAGGGTAGAGGG - Intronic
1040476839 8:47785930-47785952 TTGTATTTTAAGTGGGTACAGGG - Intronic
1042702592 8:71632649-71632671 CTTTATTTGAAGAGGGTATGAGG - Intergenic
1043479625 8:80639842-80639864 CTGTATAGGGACAGGGGACATGG - Exonic
1044263910 8:90160595-90160617 CTCTCTGTGGAGAGGGGACATGG + Intergenic
1045544315 8:103114400-103114422 TTGCATTTGGAGAGGATTCAAGG + Intergenic
1046322056 8:112592367-112592389 TTGTATTTAGAGAGGCTAAAAGG - Intronic
1047128672 8:121992742-121992764 GTGTATCTGGAAAGGATACAAGG - Intergenic
1047811434 8:128413858-128413880 TTATTTTTGGAGATGGTACAAGG + Intergenic
1049825272 8:144663636-144663658 GTGTAGCTGGAGAGGGTACCTGG - Intergenic
1050583628 9:7086758-7086780 CTGTCTTTATAAAGGGTACATGG - Intergenic
1050858827 9:10397447-10397469 TTGTTTTTGGAGAGGGAACAAGG + Intronic
1051509482 9:17861437-17861459 TTGGATTTTGAGAGGGTGCAGGG + Intergenic
1051782725 9:20707927-20707949 CTGATCTTAGAGAGGGTACATGG + Intronic
1052034272 9:23662337-23662359 CTTTACTGGGGGAGGGTACAGGG - Intergenic
1055828240 9:80352375-80352397 CTGTCTTTGGAGAGGGGAACTGG + Intergenic
1059469671 9:114495255-114495277 ATGTATTTAGAGAGTGTACCCGG + Intronic
1059801118 9:117750485-117750507 CTGTACTTGGAGAGGAAAGATGG - Intergenic
1060172417 9:121472875-121472897 CTGTATTTGGAGCGGGGATTTGG - Intergenic
1061261851 9:129484521-129484543 CTGTAGTGGGAGAGGGTCCCAGG - Intergenic
1189740264 X:44110678-44110700 CTGTGTTTGAAGAGTGTAGAAGG - Intergenic
1190976465 X:55407044-55407066 CAGTATTTGGAGAGTGTAGTGGG + Intergenic
1192204913 X:69089346-69089368 CTGTCTTTGGAGAGGGGCTATGG - Intergenic
1194029768 X:88798081-88798103 ATGTATTTTTAGATGGTACATGG - Intergenic
1194339716 X:92693556-92693578 CTGCATTTGGAGATGGTAACAGG + Intergenic
1195755234 X:108193092-108193114 CAGTCTTTGGAGAAGGTAAAGGG + Intronic
1197604877 X:128573994-128574016 CTGTATTTGGAGATTTTTCACGG + Intergenic
1197864847 X:131006911-131006933 CTGGATTTGGAAAGGGCAAAGGG + Intergenic
1199058333 X:143324721-143324743 CTGCACTTGGAGAGTGAACATGG + Intergenic
1199684618 X:150255141-150255163 CTGTCTCTGGAGAGGGAAAAGGG - Intergenic
1200648102 Y:5810339-5810361 CTGCATTTGGAGATGGTAACAGG + Intergenic