ID: 901541851

View in Genome Browser
Species Human (GRCh38)
Location 1:9923189-9923211
Sequence ATTGTATTTGGGTTGACCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 141}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901541851_901541857 13 Left 901541851 1:9923189-9923211 CCCTTGGTCAACCCAAATACAAT 0: 1
1: 0
2: 0
3: 7
4: 141
Right 901541857 1:9923225-9923247 TTATTTTATTGTTTTTGAGATGG 0: 5
1: 359
2: 2068
3: 105875
4: 90105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901541851 Original CRISPR ATTGTATTTGGGTTGACCAA GGG (reversed) Intronic
901541851 1:9923189-9923211 ATTGTATTTGGGTTGACCAAGGG - Intronic
908249703 1:62255531-62255553 ATTGTTTTTCTGTTGCCCAAAGG - Intronic
908631398 1:66112758-66112780 ATTGTTTTTCAGTTTACCAATGG + Intronic
909265570 1:73553630-73553652 ATTGTATTAGGGTTCTCTAAAGG - Intergenic
909752210 1:79176645-79176667 ATAGTATTAGGGATGACAAAGGG - Intergenic
911257042 1:95645129-95645151 ATGGTATTTGGGTTGGGCATTGG - Intergenic
912991459 1:114491294-114491316 ATTTTATTTGCATTGACCTAGGG + Intronic
914778619 1:150762246-150762268 ATTGTATATGGGGTGACATAAGG - Intronic
916820981 1:168398638-168398660 ATTGTCTTTGGGAGGACCCAGGG + Intergenic
921071147 1:211658834-211658856 ATGGTATTTCAGATGACCAAAGG - Intronic
924135226 1:240958790-240958812 GCTGTATTTGGGTGGACCCAGGG - Intronic
1070842509 10:79497078-79497100 ATTGGTTTTTGGTTAACCAATGG + Intergenic
1071186794 10:83055883-83055905 ATTGTATTAGGGTTCTCCAGAGG + Intergenic
1071660135 10:87492603-87492625 TTTCTATTTGGGGTGACGAAAGG - Intergenic
1073945808 10:108748591-108748613 ATTGTTTTTGGTTTTACCAATGG + Intergenic
1074326160 10:112453583-112453605 ATTGTTTTAGCGTTGACCATTGG + Intronic
1074851336 10:117441898-117441920 TTTGTATCTGGTTTAACCAAGGG - Intergenic
1076565106 10:131393302-131393324 ATTGCATTAGGGGTGCCCAAAGG - Intergenic
1080961459 11:37165706-37165728 ATGGGCTTTGGGTTGTCCAATGG + Intergenic
1081551362 11:44115620-44115642 GTTGTATTTGGTTTGAGAAATGG + Intronic
1082258176 11:50055405-50055427 ATAGTTTTTGGGATGTCCAAGGG - Intergenic
1087240222 11:95766445-95766467 ATTCTATTAGGGTTGATTAATGG - Intergenic
1088151418 11:106749901-106749923 ATTGTATTAGGGTTCTCCAGAGG + Intronic
1090119228 11:124007028-124007050 ATTGTTTTTGTGTTCATCAAGGG + Intergenic
1090878169 11:130809848-130809870 ATTGTATTTGAGCTGAGAAATGG + Intergenic
1093485193 12:19644558-19644580 ACTGCATTTGGGCTGACAAACGG + Intronic
1094435480 12:30416394-30416416 ATTGTATATAGGTTGGCCTAGGG - Intergenic
1095195494 12:39310563-39310585 ATTCTACTTGGGTTGAAAAATGG - Intronic
1096439831 12:51631636-51631658 ATTTTATTTTGTTTGATCAAGGG - Intronic
1098762461 12:74442073-74442095 ATTGTATGTGGGTTGTCCCCAGG + Intergenic
1099700602 12:86077330-86077352 ATAGTATTTGGGTTGGGAAATGG - Intronic
1104040125 12:125124387-125124409 ATTGTATCTTGGGGGACCAAAGG - Intronic
1105695152 13:22881269-22881291 ATTGGTGTTGGGTTGCCCAAGGG - Intergenic
1109125206 13:58508710-58508732 ATTAAATATGTGTTGACCAAAGG + Intergenic
1111276245 13:85951213-85951235 ATTATATTTGAGATGACTAAGGG - Intergenic
1113390750 13:109894053-109894075 ATTGTATCAGAGATGACCAATGG + Intergenic
1116817335 14:49596513-49596535 ATTAAATTTGGGTGGACAAAGGG + Intronic
1117019901 14:51559419-51559441 ATTCTGATTGGATTGACCAAGGG - Intronic
1117226663 14:53668015-53668037 ATTGGAGTTGGATTGACCACTGG - Intergenic
1119350888 14:73964489-73964511 GAGGTATTTGGGATGACCAAAGG + Exonic
1120575735 14:86178582-86178604 ATATAATTTGGGATGACCAATGG + Intergenic
1121355287 14:93208425-93208447 ATTGTTTTAGTGGTGACCAAAGG - Intronic
1202935210 14_KI270725v1_random:81532-81554 ATAGTATTTGGGTTGAGGATTGG - Intergenic
1125134884 15:36329766-36329788 ATTATATGTGGGTTGACATAGGG - Intergenic
1125323287 15:38511227-38511249 ATTGTGGTTCGGTTGACCATAGG - Intronic
1127831795 15:62757458-62757480 ATTATATTTAGATGGACCAACGG + Intronic
1130223100 15:82038095-82038117 ATTGGATTTAGGTAGACCCAAGG + Intergenic
1131760654 15:95619051-95619073 ACCTTATTTGGCTTGACCAAAGG - Intergenic
1135964308 16:27023116-27023138 ATTGGACTTTGTTTGACCAATGG + Intergenic
1144078262 17:11738246-11738268 AGTGTATTAGGGCTGACCACTGG - Intronic
1147312405 17:39603243-39603265 ATTGTATTTCGGTGGACTCAGGG - Intergenic
1148982415 17:51589881-51589903 ATTGGGTTTGGGATGACTAAGGG + Intergenic
1151054477 17:71015570-71015592 ATTGTAATTCTGTTTACCAAAGG + Intergenic
1151367414 17:73626455-73626477 TTTGATTTTGGGTTGGCCAAAGG + Intronic
1155448402 18:25937237-25937259 TTTGTATATGGTTTAACCAAGGG + Intergenic
1157054272 18:44208106-44208128 TTTGTATTTGGGTTCACCCCAGG + Intergenic
1157341499 18:46782173-46782195 ATAGTATTTGGGTTGAGGATTGG + Intergenic
1158643536 18:59222372-59222394 ATGGTATTTGGGGTCACCACTGG - Intronic
1159566711 18:70059247-70059269 ATTGAATTCAGGTTGACCTAAGG - Intronic
1163813216 19:19447607-19447629 ATTGTTTGTGGGTAGACCCACGG + Intronic
928101594 2:28440541-28440563 AATGTCTTTGGGTTGTCCAGAGG - Intergenic
929701264 2:44165305-44165327 TTTGTTTTTGGGTCAACCAAGGG + Intergenic
931679478 2:64732650-64732672 TTTATAACTGGGTTGACCAAGGG + Intronic
932176966 2:69611627-69611649 GTTGTATTTGGGTTCTCCAGAGG - Intronic
932691712 2:73919194-73919216 ATTGTGTTTGCTTTGACCAATGG - Intronic
932748899 2:74358256-74358278 ATTGTATTTGGATTGATGGAGGG - Intronic
938969328 2:136417808-136417830 TGTGTATTTGGGGTGACCGAAGG + Intergenic
942114740 2:172717089-172717111 ATTGTACCAGGGTTGGCCAATGG + Intergenic
1170507827 20:17046936-17046958 ATTGACTTTGGGTTAATCAAAGG + Intergenic
1170575229 20:17657494-17657516 ATTGCATTTGTGTTGACGAAGGG - Intronic
1170778678 20:19403899-19403921 ATTTTATTTTGTTTGACTAAAGG - Intronic
1175528463 20:59654360-59654382 ATTTCATTTGGGTTGTCAAATGG - Intronic
1177219515 21:18173166-18173188 ATTGAATTTAGGTTAACTAATGG - Intronic
1178198264 21:30373554-30373576 ATTTTATTTGGTTTAACTAAGGG + Intronic
1180111060 21:45651244-45651266 AGTGGATTTGGGTTGATGAAGGG + Intronic
1180590863 22:16936191-16936213 ATAGTATTTGGGTTGGCGATTGG - Intergenic
1182048202 22:27292926-27292948 ATTGGACTGGGGTTGACAAATGG + Intergenic
951705539 3:25540685-25540707 ATTTTATATGGGTTGCCCCAGGG + Intronic
951865595 3:27303499-27303521 ATTGTAATTATTTTGACCAAGGG + Intronic
955356214 3:58235476-58235498 TTTCTATTTGGGATGACTAAAGG + Intergenic
955791830 3:62596162-62596184 ATTGTATTAGGGTTCTCCAGAGG - Intronic
956035181 3:65083023-65083045 ATTGTCTTTGTGTTGTGCAAAGG + Intergenic
957169670 3:76722155-76722177 CTTGTCATTGGGTTGACCACAGG + Intronic
957197396 3:77087300-77087322 ATTGCATTTGGCTTTACAAAAGG - Intronic
959409674 3:106005257-106005279 TTTGCATTTGGGATGACAAATGG - Intergenic
961955440 3:130797512-130797534 ATTTTATTTGTGGTTACCAAGGG + Intergenic
962722644 3:138190211-138190233 ATTGAATTTGTTTTGCCCAAAGG + Intronic
966038048 3:175444880-175444902 ATTATATTTGGTTTGGCCTATGG - Intronic
970865425 4:20753163-20753185 ATTGTATTTACATTGAACAAAGG + Intronic
973670184 4:53209262-53209284 ATTGTATTTAGCTTTATCAAGGG - Intronic
974119004 4:57615329-57615351 ATTGTATTTGAGATCATCAAAGG - Intergenic
974925498 4:68292881-68292903 ATTGTATATGGTTTGAAGAAAGG - Intergenic
975660885 4:76688215-76688237 ATTGTATTTTGTTTTACCTATGG - Intronic
976217579 4:82729511-82729533 CTTGTATTTGGTTAGACCTATGG - Intronic
977279477 4:95021589-95021611 AGTGAATTTTGGTAGACCAATGG - Intronic
977625539 4:99186014-99186036 ATTGTATTAGGGTTTTCCAGAGG - Intergenic
977853745 4:101861948-101861970 ATGGTTTTTGAGTTGACTAAAGG - Intronic
977898986 4:102396805-102396827 ATAGTATTTGGGTTGAGGATTGG + Intronic
978702139 4:111660328-111660350 ATTGTATTAGGGTTCTCCAGAGG - Intergenic
979423468 4:120534906-120534928 ATTGTATTAGGGTTTTCCACAGG - Intergenic
979541403 4:121887606-121887628 ACTGTATTTGTTTGGACCAAGGG + Intronic
987740961 5:21908066-21908088 ATGGTATTTAGGTTGAGGAAAGG + Intronic
989457357 5:41659555-41659577 ATAGTATTTGGGTTGAGGATTGG - Intergenic
993378108 5:87173747-87173769 ATTTTATTTGGGTAGGCAAAGGG + Intergenic
994098199 5:95866478-95866500 ATTTTATTTAGTTTCACCAAAGG + Intergenic
994432664 5:99688298-99688320 ATTGAATTTAGGTTAATCAAAGG - Intergenic
994839191 5:104899501-104899523 ATTATATTTGAGTTGGCCAGAGG - Intergenic
995863953 5:116671257-116671279 TTTGTGTTTTGGTTGAACAAGGG + Intergenic
995870944 5:116742787-116742809 GTTGAATTTGGGTTGGCTAATGG + Intergenic
997104600 5:131004472-131004494 GTTGCATTTGCTTTGACCAAGGG - Intergenic
997190381 5:131928426-131928448 ATTTTGTTTGTGTTGACCATCGG + Intronic
1007659508 6:43475056-43475078 ATTGTTTTGGGGTTCACAAAGGG - Intergenic
1008400594 6:51058150-51058172 ATAGTATTTGGGTTGAGGATTGG + Intergenic
1008960348 6:57259857-57259879 TTTGAATGTGGGTTGACCATAGG - Intergenic
1008970191 6:57358028-57358050 AATGTATGTTGGTTGAACAAAGG + Intronic
1009532121 6:64830897-64830919 ATTGAATTTTGCTTGGCCAAAGG + Intronic
1009989762 6:70827395-70827417 ATTGAATTTTAGATGACCAAAGG + Intronic
1014314504 6:119846483-119846505 TTTGTATTTGGGTTGAGCTGTGG + Intergenic
1014361309 6:120479101-120479123 TATGTATTTGGGTTCACTAATGG + Intergenic
1014425659 6:121301962-121301984 ATTGTGTTTTGGTTAACCAAAGG + Intronic
1017342367 6:153339605-153339627 ATTGTATTTGGGTGGATCACAGG + Intergenic
1018162103 6:161054903-161054925 ATTGTATCTGGGTCCACAAATGG - Intronic
1020530732 7:9330918-9330940 CTGGTACTTGGGATGACCAAGGG + Intergenic
1021490401 7:21214128-21214150 ATTCTATTTGGGATTACCATAGG + Intergenic
1022866675 7:34428755-34428777 ATTGTATTAGGGTTCTCTAAAGG - Intergenic
1023054343 7:36279543-36279565 ATTGTATGTGGGCTGCCCAGGGG + Intronic
1023452691 7:40304339-40304361 GTTGTAAATGGGGTGACCAATGG - Intronic
1024492797 7:50004564-50004586 ATTGTATTAGGGTTTTCCAGAGG - Intronic
1024776263 7:52789951-52789973 ATTGGATTTGTGTTGATAAATGG + Intergenic
1028359204 7:89947664-89947686 CTTGGATTTGAGTGGACCAATGG - Intergenic
1035902797 8:3476168-3476190 TTTGTATTTTGGTTGAGCCAAGG - Intronic
1039905456 8:41782956-41782978 AATGGATTTGGGATGAGCAAAGG - Intronic
1040900515 8:52412997-52413019 TTTGTATTTGGGCAGACCAAAGG - Intronic
1043105443 8:76104240-76104262 ATAGTATTTGGGTTGAGGATTGG - Intergenic
1045515055 8:102852131-102852153 GTTATATTTGGCATGACCAAAGG - Intronic
1048003245 8:130397004-130397026 ATGGTATTTGGGGTGAATAAAGG + Intronic
1056313957 9:85370728-85370750 ATAGTATTTGGGTTGAGGATTGG - Intergenic
1060506348 9:124200992-124201014 ATCTGATTTGGGTTGACCACTGG - Intergenic
1061982104 9:134111661-134111683 AGTGTATTAGGGTTCTCCAAAGG - Intergenic
1187632806 X:21193822-21193844 ACTGCATAAGGGTTGACCAAAGG - Intergenic
1188856474 X:35202226-35202248 ATTATATTTGGATTTACCATTGG + Intergenic
1189146332 X:38658808-38658830 ATTGGGTTTGGGGTGACCAAAGG - Intronic
1192289254 X:69774888-69774910 ATTATATTTGTGTTGAACAGAGG + Intronic
1194463216 X:94198012-94198034 CTTGTATATGGGCTGAACAATGG - Intergenic
1196379200 X:115070260-115070282 ATTGAATTTGAGTTGCCTAAAGG - Intergenic
1197002572 X:121455142-121455164 ATAGTATTTGGGTTGGCGATTGG + Intergenic
1198842964 X:140878928-140878950 GTTTTAATTGGGTTGAACAAAGG + Intergenic
1199390203 X:147269881-147269903 ATCCTATTTGGGTTGAACAGTGG + Intergenic
1200976832 Y:9220337-9220359 ATAGTATTTGGGTTGAGGATTGG + Intergenic