ID: 901542263

View in Genome Browser
Species Human (GRCh38)
Location 1:9926381-9926403
Sequence ATGCAACTCCACCACTGAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 115}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901542263 Original CRISPR ATGCAACTCCACCACTGAAA TGG (reversed) Intronic
901542263 1:9926381-9926403 ATGCAACTCCACCACTGAAATGG - Intronic
901789535 1:11647120-11647142 CTGCATCTCCACCACTGCACTGG + Intergenic
903453111 1:23468453-23468475 ATGAAACTCCAACGCTAAAAAGG + Intronic
904946760 1:34204938-34204960 ATGCATCTCCACCTCTAAAGGGG + Intronic
910968890 1:92834206-92834228 ATGCCACTTAACCACTGAAAAGG + Intronic
912343431 1:108940834-108940856 ATGCAAGTCCATGACTGACACGG - Intronic
916095316 1:161344502-161344524 ATGCAAGGCCACCATTCAAAGGG - Intronic
916349552 1:163833656-163833678 ATGCAATTCCACCACGGCTAAGG + Intergenic
916434399 1:164763783-164763805 AAGCAACAGCAACACTGAAAAGG + Intronic
917460922 1:175228331-175228353 ATTGGACTCCACCACGGAAAGGG - Intergenic
921111077 1:212037344-212037366 ATGGAACACCAACACTGAAGAGG - Intronic
1062993774 10:1846109-1846131 TTGCAGCTCCACCACTTACAGGG - Intergenic
1064381222 10:14843411-14843433 GAGCAACTGCACCTCTGAAAAGG - Intronic
1065364058 10:24917741-24917763 TTGGGACTCCCCCACTGAAAAGG - Intronic
1065976229 10:30845264-30845286 ATGCATGTCCAAGACTGAAAAGG - Exonic
1067678282 10:48406354-48406376 AGGCAACACCACCACTGCCATGG - Intronic
1067995117 10:51263420-51263442 AAGCAACTTCACCACTGAGGCGG - Intronic
1068744211 10:60511357-60511379 ATGCGACTACAAAACTGAAAAGG + Intronic
1070403266 10:76072281-76072303 ATCCCTCTCCACCACTTAAAGGG + Intronic
1071494946 10:86161787-86161809 ATGGAACTGGATCACTGAAATGG + Intronic
1088148970 11:106721030-106721052 ATGCTTCTCCACCAATAAAAAGG + Intronic
1093746200 12:22743507-22743529 ATGCAACAACAGCATTGAAATGG - Intergenic
1097210947 12:57369192-57369214 ATGTAGCTCCACCTCTTAAAAGG + Intronic
1103767765 12:123293901-123293923 CTGCACCTCCACCACTGGAGTGG + Exonic
1105768138 13:23580551-23580573 GTGAAACTGCACCACAGAAAAGG - Intronic
1111807720 13:93058482-93058504 CTGCAATTACCCCACTGAAATGG - Intergenic
1112951496 13:105002852-105002874 ATGCAACACCAAAAATGAAAAGG - Intergenic
1116236377 14:42284658-42284680 ATGCAACTCCTCCCCAGCAAGGG - Intergenic
1117669796 14:58094978-58095000 ATGCAAATTTACCACTGAATAGG - Intronic
1118065576 14:62186965-62186987 ATGCCACACCACATCTGAAAGGG - Intergenic
1120830559 14:88994159-88994181 ATGCCAACCCACCACTGATAAGG + Intergenic
1126430847 15:48582718-48582740 ATGCAAGTACACCACAAAAATGG - Intronic
1128242872 15:66113367-66113389 ATTCCAAGCCACCACTGAAAGGG + Intronic
1128271512 15:66314360-66314382 ATTCAACTCCACCACTTACCAGG - Intronic
1134098654 16:11436253-11436275 TTGCAACTCCTCCACAGAAAAGG + Intronic
1138878199 16:60978985-60979007 GTGCATCACCACCAATGAAATGG + Intergenic
1140592534 16:76370781-76370803 ATGCAATTTCAAAACTGAAAGGG - Intronic
1141056164 16:80816610-80816632 CTGAAGCTCCACCACGGAAAAGG + Intergenic
1142649959 17:1342440-1342462 ATGAACTTCCATCACTGAAAGGG - Intergenic
1146461723 17:33051177-33051199 ATGCCTGTCCTCCACTGAAAGGG - Intronic
1148670618 17:49407365-49407387 CAGCAGCTCCACCACTGAACAGG + Intronic
1150970088 17:70018057-70018079 ATCCAAATCCACCACTCAAGGGG + Intergenic
1151495748 17:74457213-74457235 TCCCACCTCCACCACTGAAAAGG - Intergenic
1203162990 17_GL000205v2_random:68792-68814 TTGCAGCCCTACCACTGAAAAGG + Intergenic
1153470460 18:5438812-5438834 AGGCCTCTCCAGCACTGAAAAGG + Intronic
1160027297 18:75229017-75229039 ATGCAACAAAACCCCTGAAATGG - Intronic
1161056868 19:2195108-2195130 CTGCCACTCAGCCACTGAAAGGG - Intronic
1165638529 19:37364252-37364274 ATGCAAAGGCACCACTCAAAAGG - Exonic
930403381 2:50921453-50921475 AAGCATGTGCACCACTGAAATGG - Intronic
930683314 2:54280720-54280742 AGACAACTCCTCCACTAAAACGG - Intronic
934524689 2:95044373-95044395 ATGCAGTTCCCCCATTGAAAGGG - Intronic
936403472 2:112183319-112183341 CTGTAAGTCCACCTCTGAAAGGG + Intronic
939427945 2:142065078-142065100 ATGAAACTCTACCACAGACATGG - Intronic
941205203 2:162563442-162563464 AAGCAAAACCACCACTGAGAAGG - Intronic
941644245 2:168023436-168023458 CTGCACCTCCACCACTGGGAAGG - Intronic
943650737 2:190455087-190455109 CTCCAACTCCACCACTCAGAAGG - Intronic
946528698 2:220548274-220548296 ATGCAAGGCCAACTCTGAAAAGG + Intergenic
947024907 2:225726428-225726450 AAGTAACAACACCACTGAAAGGG + Intergenic
947464908 2:230334568-230334590 ATGTAAATCCAACACTGGAATGG - Intronic
1176338846 21:5624057-5624079 TTGCAGCCCTACCACTGAAAAGG - Intergenic
1176340254 21:5687130-5687152 TTGCAGCCCTACCACTGAAAAGG - Intergenic
1176472508 21:7119283-7119305 TTGCAGCCCTACCACTGAAAAGG - Intergenic
1176504573 21:7637326-7637348 TTGCAGCCCTACCACTGAAAAGG + Intergenic
1177402377 21:20623000-20623022 ATGCAAGTCCAAAACTCAAAAGG + Intergenic
1180859175 22:19067290-19067312 AGGAAAAGCCACCACTGAAATGG - Intronic
1182009575 22:26989351-26989373 ATGCACATACACCAATGAAAAGG - Intergenic
1183135412 22:35882363-35882385 TTGCAACCACACCACTGAAAGGG - Intronic
1203239518 22_KI270733v1_random:1588-1610 TTGCAGCCCTACCACTGAAAAGG - Intergenic
952837797 3:37619201-37619223 ATGCCTCTCCACTACTGATATGG + Intronic
953862888 3:46560473-46560495 ATGCTACCCCAACACAGAAAAGG + Intronic
956521130 3:70105499-70105521 ATGCCACTCAAATACTGAAACGG - Intergenic
961253941 3:125530646-125530668 AAGCAACACCTTCACTGAAATGG + Intronic
962451504 3:135521470-135521492 ACACAACTCCACCAGTGAAGTGG - Intergenic
962680635 3:137796163-137796185 CTCAAACCCCACCACTGAAACGG - Intergenic
965357163 3:167690316-167690338 ATGCAAATGCACTAATGAAAGGG + Intronic
967668321 3:192201316-192201338 ATGGAACACAACAACTGAAATGG + Intronic
970138171 4:12949449-12949471 ATGTAAACCCACCACTGAACAGG - Intergenic
972774334 4:42227557-42227579 ATGCAACGGCACCATTGACAGGG - Intergenic
975059925 4:69985054-69985076 ATGCACCTGCACCCCAGAAAGGG + Intergenic
975085705 4:70336158-70336180 AGACACCTCCACAACTGAAACGG + Exonic
977743259 4:100512979-100513001 ATGTAACTTCACCAATGAAAAGG + Intronic
980434015 4:132745146-132745168 ATTAAGGTCCACCACTGAAAGGG - Intergenic
983176456 4:164594052-164594074 AGTCAACTCCATCACTCAAATGG + Intergenic
986018529 5:3779503-3779525 GTGGAACTCCACTACAGAAATGG - Intergenic
986601624 5:9478599-9478621 ATGCAAGTCCAAAACTGAGAAGG - Intronic
993721858 5:91329262-91329284 ATGAAATTCCAACACTGAAGAGG - Intergenic
995518690 5:112978639-112978661 ATTCAAATGAACCACTGAAAAGG + Intronic
996611888 5:125392218-125392240 ATCCAACTTCTCCCCTGAAATGG - Intergenic
996651485 5:125882329-125882351 ATGCAACTCCCCCACTCAAAAGG + Intergenic
997242638 5:132319041-132319063 ATGTAAATCCACTTCTGAAAGGG + Intronic
1006956910 6:37882102-37882124 ACCCAACTGGACCACTGAAAAGG - Intronic
1016805681 6:148210059-148210081 ATGAAACATCAGCACTGAAAAGG + Intergenic
1017108654 6:150912000-150912022 ATGCACCTCCTCCTCTGATATGG - Intronic
1022197854 7:28086333-28086355 ATGCACCTCCCCAAATGAAACGG - Intronic
1028218986 7:88172462-88172484 ATGCAACTCAACAATGGAAAAGG - Intronic
1028286688 7:89011611-89011633 ATGCAACTCCACAACCCAATAGG + Intronic
1029669547 7:102019684-102019706 GTACAACTCCACCACGGGAAGGG - Intronic
1030114056 7:106049943-106049965 GTGTAACTCCAACAATGAAATGG - Intergenic
1035091668 7:156318168-156318190 ATGAAACTCCACCACCAGAAGGG - Intergenic
1035733986 8:1874415-1874437 ATGCAGCTCCAGCTCTCAAAGGG + Intronic
1036759890 8:11500871-11500893 ATCCAATTGCACCACAGAAATGG - Intronic
1038006309 8:23433263-23433285 CTGCAACCCTACCTCTGAAATGG + Intronic
1038687064 8:29728483-29728505 GTGCAGCTCCAGCACAGAAAAGG + Intergenic
1041497808 8:58506469-58506491 CTGCATCTCCAGCACTTAAAAGG - Intergenic
1047323516 8:123813111-123813133 ATGGAACTCTTCCTCTGAAAAGG + Exonic
1048829858 8:138465471-138465493 AGGCAGCTCCATCAGTGAAAAGG - Intronic
1049952710 9:660745-660767 CAGCAACTCTACCACTGGAAGGG + Intronic
1050301848 9:4266794-4266816 ATTCAACTTCACTACTGAACAGG + Intronic
1050839868 9:10134867-10134889 CAGCAGCTCAACCACTGAAATGG + Intronic
1055686116 9:78776760-78776782 ATGCATTTACATCACTGAAAGGG - Intergenic
1060465460 9:123900669-123900691 TTGCAGCTCCACCACACAAACGG + Intronic
1060591081 9:124817357-124817379 ATGCCACTCCACCACTGCAGTGG + Intergenic
1203422813 Un_GL000195v1:10863-10885 TTGCAGCCCTACCACTGAAAAGG + Intergenic
1185744290 X:2559583-2559605 ATGCAATTCTCCCAATGAAATGG + Intergenic
1185776835 X:2809968-2809990 ATGCAGCTCCACCTCTGGATGGG + Intronic
1188461776 X:30435457-30435479 CTACAGCTCCACCACTGAGAAGG + Intergenic
1192166809 X:68831690-68831712 ATGCAGCTCCACAGCTGGAAAGG + Intronic
1192225115 X:69222398-69222420 ATGAAATTCCACAAGTGAAAAGG - Intergenic
1192238280 X:69310014-69310036 ATGAAAGTCCACCCCAGAAAAGG - Intergenic
1195784560 X:108505038-108505060 ATGCTACTCAACCACAAAAAAGG + Intronic
1198590923 X:138180487-138180509 AAGCAACTTCACCAATGCAATGG + Intergenic
1201293159 Y:12441498-12441520 ATGCAGCTCCACCTCTGGACGGG - Intergenic