ID: 901542988

View in Genome Browser
Species Human (GRCh38)
Location 1:9933005-9933027
Sequence ACTTTGGGCGGATCACGAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 183}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901542985_901542988 -9 Left 901542985 1:9932991-9933013 CCTATAATCTCAACACTTTGGGC 0: 2
1: 252
2: 6569
3: 76254
4: 362376
Right 901542988 1:9933005-9933027 ACTTTGGGCGGATCACGAGGCGG 0: 1
1: 0
2: 2
3: 5
4: 183
901542982_901542988 10 Left 901542982 1:9932972-9932994 CCAGGCGCAGTGGCTCACGCCTA 0: 684
1: 13733
2: 68548
3: 119827
4: 136117
Right 901542988 1:9933005-9933027 ACTTTGGGCGGATCACGAGGCGG 0: 1
1: 0
2: 2
3: 5
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901542988 Original CRISPR ACTTTGGGCGGATCACGAGG CGG Intronic
901542988 1:9933005-9933027 ACTTTGGGCGGATCACGAGGCGG + Intronic
902319682 1:15652432-15652454 ACTTTGGGAGGCTCCGGAGGGGG + Intronic
903842475 1:26253631-26253653 ACTTTGGGAGGCTGAGGAGGGGG - Intronic
904067282 1:27763520-27763542 ACTTTGGGAGGCTGATGAGGTGG - Intergenic
904146426 1:28395906-28395928 ACTTTGGGAGGCCGACGAGGCGG - Intronic
905088901 1:35410719-35410741 GAGGTGGGCGGATCACGAGGTGG - Intronic
908270150 1:62414325-62414347 ACTTTGGGAGGCTGAGGAGGGGG + Intergenic
908783989 1:67717162-67717184 ACATGGGGAGGATCAAGAGGCGG - Intronic
911962377 1:104321682-104321704 ACTTTGGGCAGCTCATGAAGAGG + Intergenic
912273211 1:108230735-108230757 ACTTTGGGAGGCTAAGGAGGTGG - Intronic
912295009 1:108463587-108463609 ACTTTGGGAGGCTAAGGAGGTGG + Intronic
912335621 1:108859728-108859750 ACTTTGGGAGGCTGAGGAGGAGG - Intronic
914796411 1:150923988-150924010 ACTTTGGGAGGCCCAGGAGGCGG + Intergenic
915220538 1:154370985-154371007 AAGGTGGGCAGATCACGAGGAGG + Intergenic
915389039 1:155524276-155524298 ACTTTGGGAGGCTGACGGGGCGG + Intronic
916043168 1:160978687-160978709 ACTTTGGGAGGCTGAGGAGGAGG + Intergenic
916052130 1:161043867-161043889 ACTTTGGGAGGCTGCCGAGGTGG - Intronic
916163979 1:161948068-161948090 ACTTTGGGAGGCTGACGGGGGGG - Intronic
918010780 1:180584582-180584604 ACTTTGGGAGGCTGAGGAGGGGG - Intergenic
918497606 1:185157356-185157378 ACTTGGGGCGGGGGACGAGGGGG - Intronic
919995245 1:202742115-202742137 ACTTTGGGAGGCTGAGGAGGTGG - Intronic
922532095 1:226352529-226352551 ACTTTGGGAGGCTGAGGAGGAGG + Intergenic
1066206406 10:33193510-33193532 ACTTTAGGCAGTCCACGAGGTGG + Intronic
1066558272 10:36639805-36639827 ACTTTGGGAGGAGGCCGAGGTGG - Intergenic
1067103566 10:43350460-43350482 ACTTTGGGAGGCTGAGGAGGTGG + Intergenic
1069480954 10:68781609-68781631 ACTTTGGGAGGATAACGAGGTGG + Intronic
1070610814 10:77931198-77931220 ACTTTGGGAGGCCCAAGAGGTGG - Intergenic
1074834525 10:117276365-117276387 ACTTTGGGAGGCTGAGGAGGGGG + Intronic
1074935015 10:118169625-118169647 ACTTTGGGAGGATGAGGCGGGGG + Intergenic
1075429910 10:122371642-122371664 ACTTTGGGAGGCTGAGGAGGGGG + Intergenic
1076116640 10:127906095-127906117 ACTCTGGGCAAATCACGTGGGGG + Intergenic
1078216606 11:9317123-9317145 GAGGTGGGCGGATCACGAGGTGG + Intergenic
1078658661 11:13266350-13266372 ACTTTGGGAGGCTGAGGAGGGGG + Intergenic
1079194316 11:18311969-18311991 GCTTTGGGCAGTTCAGGAGGAGG - Exonic
1083740353 11:64707143-64707165 AAGGTGGGCGGATCATGAGGTGG + Intronic
1088146726 11:106689744-106689766 ACTTTGGGAGGCTCACAAGGTGG + Intronic
1090231707 11:125111627-125111649 ACTTAGGGCGAATCACAAGTGGG + Exonic
1090339584 11:126005054-126005076 ACTTTGGGAGGATTAGGTGGTGG + Intronic
1091745244 12:2987819-2987841 ACTTTGGGAGGCTGAGGAGGAGG + Intronic
1092447543 12:8571343-8571365 ACTTTGGGAGGCTGAGGAGGAGG + Intergenic
1093499837 12:19798998-19799020 ACTTTGGGAGGCTGAGGAGGGGG + Intergenic
1095107523 12:38253293-38253315 ACTTTGGGAGGCTGAGGAGGGGG - Intergenic
1096703088 12:53400005-53400027 ACTTTGGGAGGCCCAGGAGGTGG - Intronic
1097008189 12:55933668-55933690 CCTCTGGGAGGATGACGAGGTGG - Intronic
1097061074 12:56284397-56284419 ACTTTGGGAGGCTGAGGAGGAGG + Intronic
1099866499 12:88288988-88289010 ACTTTGGGAGGCTGAGGAGGTGG - Intergenic
1100408694 12:94293862-94293884 ACTTTGGGAGGAAGAAGAGGAGG - Intronic
1102670091 12:114610916-114610938 ACTTTGGGCGGCTGAGGTGGGGG + Intergenic
1104025573 12:125023825-125023847 ACTTTGGGAGGCTGAGGAGGTGG + Intronic
1104240090 12:126980013-126980035 ACTTTGGGAGGCTGAGGAGGTGG - Intergenic
1105834824 13:24200492-24200514 ACTTGGGGCTGAGAACGAGGTGG - Intronic
1118011117 14:61611574-61611596 ACTTTGGGAGGCTCAGGTGGGGG - Intronic
1119270831 14:73302968-73302990 ACTTTGGGAGGAAGCCGAGGAGG + Intronic
1122138317 14:99647168-99647190 ACTCTGGGAGGATGAGGAGGGGG + Intronic
1124969206 15:34468319-34468341 ACTTTGGGAGTATCAAGAGTCGG + Intergenic
1126132856 15:45359908-45359930 ACTGTGGTCTGATAACGAGGTGG - Intergenic
1127044804 15:55014190-55014212 ACTTTGCTGGGATCAAGAGGAGG - Intergenic
1127143640 15:56002580-56002602 ACTTTGGGAGGCTGAGGAGGTGG - Intergenic
1127614105 15:60666427-60666449 ACTTTGGGAGGCTGAGGAGGGGG - Intronic
1127769293 15:62218184-62218206 ACTTTGGGAGGCTGAGGAGGAGG - Intergenic
1129036783 15:72655037-72655059 ACTTTGGGCGGATGACTACTGGG + Intronic
1129213104 15:74082188-74082210 ACTTTGGGCGGATGACTACTGGG - Intronic
1129397296 15:75258898-75258920 ACTTTGGGCGGATGACTACTGGG + Intronic
1129400907 15:75283175-75283197 ACTTTGGGCGGATGACTACTGGG + Intronic
1129916420 15:79277254-79277276 ACTTTGGGAGGCTGACGGGGGGG + Intergenic
1130327138 15:82890039-82890061 ACTAAGGGAGGAACACGAGGTGG + Intronic
1134440715 16:14298334-14298356 ATTTTGGGAGGCTCAGGAGGTGG + Intergenic
1138785611 16:59842180-59842202 ACTTTGGGAGGCTGACGCGGGGG - Intergenic
1139357500 16:66375861-66375883 ACTTTGGGAGGCTGACGCGGCGG + Intronic
1144741404 17:17584552-17584574 ACTTTGGGAGGAGGCCGAGGTGG - Intronic
1145074510 17:19840630-19840652 ACTTTGGGAGGATGAGGCGGGGG + Intronic
1145229244 17:21159974-21159996 ACTTTGGGAGGCTGACGTGGTGG + Intronic
1147641905 17:42007765-42007787 ACTTTGGGAGGCTGAGGAGGTGG - Intronic
1147916597 17:43891270-43891292 ACTTTGGGAGGAGGCCGAGGTGG + Intronic
1149652210 17:58282524-58282546 ACAGTGGGTGGATCAGGAGGAGG - Intergenic
1151009896 17:70482583-70482605 ACTTTGGGAGGATCAAGTAGGGG + Intergenic
1151645402 17:75427463-75427485 ACTTTGGGAGGAGGCCGAGGTGG + Intergenic
1153277155 18:3378623-3378645 ACTTTGGGAGGCTGAGGAGGTGG + Intergenic
1157426615 18:47589807-47589829 ACTTTGGGAGGCTGAGGAGGGGG + Intergenic
1158720766 18:59922384-59922406 ACTTTGGGAGGAGGCCGAGGTGG - Intergenic
1159474992 18:68910043-68910065 ACTTTGGGAGGATGAGGAGGAGG + Intronic
1161615843 19:5269675-5269697 ACTTTGGGAGGCTGAGGAGGTGG + Intronic
1165179546 19:33955971-33955993 ACTTTGGGAGGCTGAGGAGGGGG - Intergenic
1165463044 19:35955351-35955373 ACTTTGGGAGGCTGAGGAGGAGG + Intergenic
1165984305 19:39754161-39754183 ACTTTGGGAGGATCACGAGCCGG + Intergenic
1166153232 19:40890491-40890513 ACTTTGGGAGGCTAACGGGGGGG + Intronic
1166248787 19:41551400-41551422 ACTTTGGGAGGCCCAGGAGGTGG - Intronic
1166759622 19:45216329-45216351 ACTTTGGGAGGAGGCCGAGGCGG + Intronic
1167497001 19:49825586-49825608 ACTTTGGGAGGGTGAGGAGGCGG + Intronic
928996233 2:37294338-37294360 ACTTTGGGAGGCTGACGTGGGGG - Intronic
929504074 2:42514629-42514651 ACTTTGGGAGGAGCCCGAGGTGG - Intronic
931615242 2:64149286-64149308 ACTTTGGGAGGCTGAGGAGGAGG - Intergenic
931770571 2:65493668-65493690 ACTTTGGGAGGCTGAGGAGGCGG + Intergenic
933864867 2:86507106-86507128 ACTTTGGGAGGCTCAGGTGGGGG - Intronic
935402954 2:102679607-102679629 GAGGTGGGCGGATCACGAGGTGG - Intronic
936456681 2:112680582-112680604 ACTTTGGGAGGCTGAGGAGGGGG - Intergenic
936580420 2:113695477-113695499 ACTTTGGGAGGCTGAGGAGGGGG + Intergenic
937505791 2:122535037-122535059 ACTTTGGGAGGCTGAAGAGGGGG + Intergenic
939518960 2:143205016-143205038 ACTTTGGGAGGCTGAGGAGGGGG + Intronic
940426094 2:153533493-153533515 ACTTTGGGAGGATGAGGCGGTGG - Intergenic
942828792 2:180213671-180213693 ACTTTGGGAGGCTGAGGAGGTGG - Intergenic
944289811 2:197992506-197992528 ACTTTGGGAGGCTGAGGAGGGGG - Intronic
944958297 2:204838117-204838139 ACTTTGTGCTGAGCAAGAGGAGG + Intronic
945089576 2:206166222-206166244 ACTTTGGGAGGCTGAGGAGGGGG - Intergenic
946505840 2:220299803-220299825 ACTTTGGGAGGCTGAGGAGGTGG + Intergenic
1171908539 20:30921094-30921116 ACTTTGGGCGGGATCCGAGGTGG - Intergenic
1171996476 20:31735669-31735691 ACTTTGGGAGGCTGAGGAGGGGG - Intergenic
1174773914 20:53326024-53326046 ACTTTGGGAGGCTGAGGAGGGGG - Intronic
1174807719 20:53618876-53618898 ACTTTGGGCGACTGAGGAGGTGG + Intergenic
1174943508 20:54958513-54958535 ACTTTGGGTGGATCACTTTGAGG - Intergenic
1174949560 20:55029226-55029248 AAGGTGGGCGGATCATGAGGTGG - Intergenic
1175114527 20:56672905-56672927 ACTTTGGGAGGCTGAGGAGGGGG - Intergenic
1180060908 21:45384488-45384510 ACTTTGGGAGGCTAAGGAGGGGG - Intergenic
1184796746 22:46737648-46737670 ACTGTGGATGGATCCCGAGGGGG - Intronic
949966767 3:9363233-9363255 ACTTCAGGCGGATCTCGTGGCGG + Exonic
950313462 3:11979274-11979296 ACTTTGGGAGGAGGGCGAGGCGG + Intergenic
953545877 3:43863327-43863349 ACTTTGGGTGGCTGAGGAGGAGG + Intergenic
954559675 3:51546181-51546203 ACTTTGGGAGGCTGAGGAGGGGG - Intronic
955796487 3:62642660-62642682 ACTTTGGGAGGATGAGGCGGGGG + Intronic
957055486 3:75439372-75439394 ACTTTGGGAGGGTGACGTGGGGG + Intergenic
959927414 3:111939050-111939072 ACTTTGGGAGGCTGAGGAGGGGG - Intronic
962745206 3:138392315-138392337 ACTTTGGGAGGATAAAGCGGAGG - Intronic
965020439 3:163221947-163221969 ACTTTGGGAGGCTGAGGAGGCGG - Intergenic
965162481 3:165152269-165152291 ACTTTGGGAGGATCACATTGAGG - Intergenic
967978253 3:195047428-195047450 AAGGTGGGTGGATCACGAGGTGG - Intergenic
969214242 4:5709807-5709829 ACTTTGGGAGGCTCAAGTGGAGG - Intergenic
971204234 4:24547704-24547726 ACTTTGGGAGGCCCAGGAGGGGG + Intronic
971337574 4:25738131-25738153 ACTTTGGGAGGTTCAGGCGGAGG - Intergenic
972765082 4:42145461-42145483 AAGGTGGGCAGATCACGAGGTGG + Intronic
978159566 4:105529564-105529586 GAGGTGGGCGGATCACGAGGTGG + Intergenic
979287236 4:118940229-118940251 ACTTTGGGAGGATCATGAGACGG - Intronic
979889726 4:126076281-126076303 ACTTTGGGAGGAGCCCAAGGTGG + Intergenic
985307213 4:188556449-188556471 ACTTTGGGAGGCTGAGGAGGAGG - Intergenic
988208042 5:28165911-28165933 ACTTTGGGAGGCTGAGGAGGCGG + Intergenic
989262730 5:39436507-39436529 ACTTTGGGAGGTTGAGGAGGGGG + Intronic
993307357 5:86289346-86289368 ACTTTGGGAGGCTAAGGAGGTGG + Intergenic
998687521 5:144546192-144546214 ACTTTGGGAGGCCCAGGAGGGGG + Intergenic
999020334 5:148158659-148158681 ACTTTGGGAGGCTGACGGGGGGG - Intergenic
1001111689 5:168901880-168901902 ACTATGGGCAGAGCACTAGGAGG - Intronic
1001390498 5:171375033-171375055 ACTTTGGGAGGCTGAGGAGGCGG + Intergenic
1001713708 5:173797940-173797962 ACTTTGGGAGGCTCAGGAGGGGG - Intergenic
1002562135 5:180089769-180089791 ACTTTGGGAGGATGAGGTGGGGG + Intergenic
1003298225 6:4853031-4853053 ACTTTGGGAGGCCCAAGAGGAGG - Intronic
1004205411 6:13587511-13587533 ACTTTACGTGGATCACAAGGTGG - Intronic
1004256804 6:14071835-14071857 ACTTTGGGAGGCCGACGAGGCGG + Intergenic
1006633877 6:35448598-35448620 ACTTTGGGAGGCTGACGGGGAGG + Intergenic
1007899157 6:45394140-45394162 AAGGAGGGCGGATCACGAGGAGG - Intronic
1008807020 6:55441933-55441955 ACTTTGGGAGGCTGAGGAGGGGG - Intronic
1009756385 6:67945878-67945900 ACTTTGGGAGGTTGAGGAGGTGG - Intergenic
1012804281 6:103875466-103875488 ACTTTGGGAGGCTGAGGAGGAGG + Intergenic
1013528936 6:111001615-111001637 ACTTTGGGAGGCTGAGGAGGAGG - Intronic
1013581069 6:111535229-111535251 ACTTTGGGAGGATGAGGTGGGGG - Intergenic
1016027344 6:139300652-139300674 ACTTTGGGAGGCTGACGTGGTGG + Intergenic
1017102756 6:150863227-150863249 ACTTTGGGAGGAGGCCGAGGAGG + Intergenic
1017476478 6:154799220-154799242 ACTTTGGGAGGCTGACGTGGGGG - Intronic
1019202170 6:170326986-170327008 ACTTTGGGAGGCTGACGTGGGGG - Intronic
1019255863 7:50448-50470 GAGGTGGGCGGATCACGAGGTGG + Intergenic
1019902856 7:4037372-4037394 ACTTTGGGAGGATGAGGTGGGGG + Intronic
1022711899 7:32858828-32858850 ATTTTGGGGGGAACAAGAGGAGG + Intergenic
1023963779 7:44950155-44950177 ACTTTGGGAGGCTGAGGAGGAGG + Intergenic
1025089443 7:56050508-56050530 ACTTTGGGAGGATGAGGCGGGGG - Intronic
1026799374 7:73389603-73389625 ACTTTGGGAGGCTGAGGAGGAGG - Intergenic
1026818871 7:73533266-73533288 ACTTTGGGAGGCTGAGGAGGAGG - Intergenic
1030174973 7:106643075-106643097 ACTTTGGGAGGAGGCCGAGGCGG - Intergenic
1031536111 7:122935261-122935283 ACTTTGGGAGGCTGAAGAGGGGG - Intergenic
1033197246 7:139338387-139338409 ACTTTGGGAGGCTCAAGGGGGGG - Intergenic
1033636911 7:143220258-143220280 ACTTTGGGAGGCTGAGGAGGAGG - Intergenic
1034181140 7:149139139-149139161 GAGGTGGGCGGATCACGAGGAGG - Intronic
1036423527 8:8620526-8620548 ACTTTGGGAGGCTGAGGAGGCGG + Intergenic
1036452473 8:8880926-8880948 ACTTTGGGAGGCTGAGGAGGTGG - Intronic
1036524516 8:9522249-9522271 ACTTTGGGAGGCTGAGGAGGGGG - Intergenic
1037858079 8:22385750-22385772 ACTTTGGGAGGATGAGGTGGGGG + Intronic
1039395334 8:37220699-37220721 ACTATGGGAGGCCCACGAGGAGG + Intergenic
1040711960 8:50199459-50199481 ACTTTGGGAGGCTGAGGAGGTGG - Intronic
1042224230 8:66503088-66503110 ACTTTGGGAGGATGAGGTGGCGG - Intronic
1043507214 8:80914347-80914369 ACTTTGGGGGTATCTCGAGTAGG + Intergenic
1043977030 8:86594964-86594986 ACTTTGGGAGGCTCAGGTGGCGG - Intronic
1055696201 9:78887303-78887325 ACTTTGGGAGGCTGACGGGGAGG - Intergenic
1057120083 9:92563791-92563813 ACTTTGGGAGGAGGAGGAGGAGG - Intronic
1060486343 9:124049790-124049812 AAGGTGGGCGGATCACAAGGAGG - Intergenic
1060640505 9:125234298-125234320 ACTTTGGGAGGCTGAGGAGGTGG + Intergenic
1186970662 X:14839044-14839066 ACTTTGGGAGGAGGTCGAGGAGG + Intergenic
1187509455 X:19904418-19904440 ACTTTGGGAGGCTGAGGAGGGGG - Intergenic
1189392012 X:40584297-40584319 ACTTTGGGAGGCTGAGGAGGAGG - Intronic
1189543420 X:42016509-42016531 ACTTTGGGAGGCTGAGGAGGGGG + Intergenic
1191729882 X:64322239-64322261 ACTTTGGGAGGCTAACGTGGAGG - Intronic
1192154626 X:68734760-68734782 ACTTTGGGAGGCTAAGGAGGGGG - Intergenic
1195142027 X:101971090-101971112 ACTTTGGGAGGATGAGGTGGGGG + Intergenic
1195365828 X:104124502-104124524 ACTTTGGGAGGCTCTGGAGGAGG + Intronic
1198153590 X:133934765-133934787 ACTTTGGGAGGCTGAGGAGGAGG - Intronic
1199791103 X:151155948-151155970 ACTTTGGGAGGATGAGGCGGTGG - Intergenic