ID: 901549533

View in Genome Browser
Species Human (GRCh38)
Location 1:9985495-9985517
Sequence AACAGTTTGTGGTAGTCTGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 132}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901549530_901549533 7 Left 901549530 1:9985465-9985487 CCCTAAGTGAGGACAAATAAAGC 0: 1
1: 2
2: 1
3: 17
4: 130
Right 901549533 1:9985495-9985517 AACAGTTTGTGGTAGTCTGATGG 0: 1
1: 0
2: 0
3: 14
4: 132
901549531_901549533 6 Left 901549531 1:9985466-9985488 CCTAAGTGAGGACAAATAAAGCT 0: 1
1: 1
2: 1
3: 18
4: 177
Right 901549533 1:9985495-9985517 AACAGTTTGTGGTAGTCTGATGG 0: 1
1: 0
2: 0
3: 14
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901549533 Original CRISPR AACAGTTTGTGGTAGTCTGA TGG Exonic
900083651 1:876419-876441 AACAGTTTGGGGGAGTATGGGGG - Intergenic
901549533 1:9985495-9985517 AACAGTTTGTGGTAGTCTGATGG + Exonic
906119743 1:43381435-43381457 AACAGTTTATAGGAGTCTGAGGG + Intergenic
913257810 1:116971067-116971089 AACAGTCTCTGGTAGGATGATGG - Intronic
915650923 1:157310383-157310405 AACATTTTTTGGTAGTGAGAAGG - Intergenic
916213728 1:162378827-162378849 AAAAGTTTGTGGGAGCCTGGCGG + Exonic
916981513 1:170143271-170143293 CACAGTTTGTGGTACACAGATGG - Intergenic
917188240 1:172386415-172386437 AACACTATGTGGGAGTCTCAGGG - Intronic
918622139 1:186618013-186618035 AACACTTTGTTTTAGTCTGAGGG - Intergenic
919173034 1:193981041-193981063 AACAGATTGTGGTTGTTTAAAGG - Intergenic
922526179 1:226305928-226305950 AACAGTTTGGGCTATGCTGATGG + Intronic
1064780757 10:18835762-18835784 CACAGTGTCTGGAAGTCTGATGG - Intergenic
1068021797 10:51594653-51594675 AAGAGTTTGTGTTAGGCTAAAGG - Intronic
1070272747 10:74973445-74973467 AAAAGATGGTGGTAGTCTGTTGG - Intronic
1071906163 10:90176208-90176230 AAATGTTTATTGTAGTCTGAAGG + Intergenic
1073092741 10:100956452-100956474 AACACTTTGTGCTACTCTGTGGG + Exonic
1076721452 10:132395199-132395221 AACAGTTTGGGGTGTGCTGAGGG - Intergenic
1078384935 11:10881761-10881783 GAAAATTTGTGATAGTCTGAAGG + Intergenic
1078532819 11:12150044-12150066 AACAGATTGTGGTGGTTTGATGG + Intronic
1079154570 11:17933074-17933096 AACATTTTGTGGTATACTGGAGG - Intronic
1086301837 11:85434767-85434789 AACTGTTTGGAATAGTCTGAGGG - Intronic
1089990663 11:122856772-122856794 GAAAGTTTGTGGTAGTCAGAGGG - Intronic
1091649727 12:2301037-2301059 GACAGCTGGTGGTAGTCTGCAGG + Intronic
1092690512 12:11104272-11104294 AACAATTTGGGATAGTCAGAAGG - Intronic
1094862138 12:34479645-34479667 AAGTGTTTGTAGTACTCTGATGG - Intergenic
1097201999 12:57286952-57286974 CACAGTTTGATGTAGTCTGATGG + Intronic
1098058131 12:66530741-66530763 ACCAGTTTGTGGAAGTTTTATGG - Intronic
1105869632 13:24493169-24493191 AACATTTTCTGGTGGTCTGGAGG + Intronic
1107292891 13:38877177-38877199 AAGAGTCTCTGGTTGTCTGATGG + Exonic
1107871120 13:44747458-44747480 AAGAGTATGTGAAAGTCTGAGGG - Intergenic
1110296717 13:73876219-73876241 AATAATCTGTGGTAGTGTGAAGG - Intronic
1110990975 13:82042104-82042126 AAAAGTCTGTGGTAGCCTGACGG + Intergenic
1114205183 14:20564360-20564382 AACACTTTGAGTTGGTCTGATGG + Intergenic
1117205057 14:53433707-53433729 AAGAGTTTTGGGTATTCTGAAGG + Intergenic
1119099144 14:71863951-71863973 AACAGTTTGGGCTAGCCAGATGG - Intergenic
1122483195 14:102060980-102061002 ACCAGTTTGTGGTAATTTGTTGG + Intergenic
1122587901 14:102823116-102823138 AAGAGTTTGAGGTAGACAGATGG + Intronic
1202912301 14_GL000194v1_random:130000-130022 TAAAATTTGTGGAAGTCTGATGG - Intergenic
1202880334 14_KI270722v1_random:52637-52659 TAAAATTTGTGGAAGTCTGATGG + Intergenic
1125138262 15:36369645-36369667 AACAGTTTGTGTAAGTGTGTGGG - Intergenic
1127232070 15:57007522-57007544 AACAGTTTATGGCAGGGTGAGGG - Intronic
1131262913 15:90897917-90897939 AACAGTTTTTGGTAGTTGCAAGG + Intergenic
1133302841 16:4793355-4793377 CAGAGTTTGTGGTAGTGTTACGG + Intronic
1139583013 16:67884300-67884322 TACAGCGTGTGGTAGTCAGAAGG + Exonic
1141966509 16:87448723-87448745 AACATTTTGTGGGAGGCTGAGGG - Intronic
1148734902 17:49859897-49859919 AGCACTTTGTGGAAGGCTGAGGG - Intergenic
1150489077 17:65561902-65561924 AACAGTTTCTGGTAGCATTATGG + Intronic
1153486240 18:5601521-5601543 AAGATTTTGTGGAAATCTGAAGG - Intronic
1155380398 18:25216446-25216468 ACCATTTTGTGTTACTCTGAAGG + Intronic
1158130552 18:54148215-54148237 AACAGTATGTGGCAGGCAGAAGG + Intergenic
1158153202 18:54395063-54395085 AACACTTTGAGTTGGTCTGATGG - Intergenic
1160658734 19:288331-288353 AGGAGTTTGTGTTTGTCTGAGGG - Intronic
1161794154 19:6376747-6376769 AACAGCTTGTGATTGTCCGAAGG + Intronic
1162265139 19:9566882-9566904 AACATTTGGTGGCAGGCTGAAGG + Exonic
1164736997 19:30548941-30548963 AACTGCTTGTAGAAGTCTGATGG - Exonic
1167392502 19:49205143-49205165 CACAGTTTTTGGTACTCTGGCGG - Intronic
1202655946 1_KI270708v1_random:21734-21756 TAAAATTTGTGGAAGTCTGATGG + Intergenic
925536042 2:4917790-4917812 AACATTTTGTGGTAGGGAGAAGG - Intergenic
929506106 2:42529437-42529459 AACAGTAGGTGGTTGTCTTATGG - Intronic
929973150 2:46602965-46602987 AATAGTTTTTGGTAGTCTTTAGG - Intronic
933322034 2:80788525-80788547 AACAGTTTCTGGTTGTTTGGTGG + Intergenic
934048322 2:88190130-88190152 ATCAGTGTGTGGTGGTCTGAAGG + Intergenic
939536486 2:143437457-143437479 AAGTGTTTCTGGTGGTCTGAAGG - Intronic
940459942 2:153952221-153952243 AACACTTTGTGGAAATTTGAGGG + Intronic
941551426 2:166920484-166920506 AAGAGTATGTGGTAGTTTGGGGG - Intronic
942915826 2:181305328-181305350 AAAAGTTTGTGGTATTGTGATGG - Intergenic
942990933 2:182201688-182201710 AACAGTTTGCAGCAGCCTGAAGG - Exonic
944532416 2:200680507-200680529 AACAGTGTGTGTTTGTCTCAGGG + Intergenic
944590589 2:201213821-201213843 ATCAGTTTGTCGTAGACAGATGG + Intronic
944928988 2:204496884-204496906 CACAGTTTGTGTCAGACTGAGGG - Intergenic
948311837 2:236993052-236993074 AACAGTTTGTGAAAGCTTGAAGG - Intergenic
1171296851 20:24024654-24024676 AACAGTTTCTGCTTGTATGACGG - Intergenic
1176631658 21:9144673-9144695 TAAAATTTGTGGAAGTCTGATGG - Intergenic
1180350668 22:11799543-11799565 TAAAATTTGTGGAAGTCTGATGG + Intergenic
1180374946 22:12082937-12082959 TAAAATTTGTGGAAGTCTGATGG + Intergenic
1180387542 22:12192532-12192554 TAAAATTTGTGGAAGTCTGATGG - Intergenic
1183999598 22:41663374-41663396 AACAGTTTTGGGTAAACTGATGG + Intronic
1185260484 22:49859084-49859106 AACAGCATGTGGAGGTCTGATGG - Intronic
949582041 3:5398295-5398317 CCCAGTCTGTGGTATTCTGATGG - Intergenic
958496827 3:94855284-94855306 AACAGTTTGTTCTATTCTGTTGG - Intergenic
960143260 3:114171794-114171816 AGTAGTTGGTGGTAGTCTGCAGG + Exonic
963642200 3:147874672-147874694 AATAGTTTGTGGTAGGATGCTGG + Intergenic
965200591 3:165653013-165653035 AATATTTTCTGGTATTCTGATGG + Intergenic
965611205 3:170545900-170545922 AACAGTTTTTGGGAGGCTGCTGG - Intronic
966118514 3:176495004-176495026 AGCACTTTCTGATAGTCTGAAGG + Intergenic
966832397 3:184020971-184020993 ACCAGGTTGTGGTAGAATGAAGG + Intergenic
972851069 4:43051557-43051579 CCCAGTCTGTGGTAGTCTGTGGG + Intergenic
974631665 4:64498622-64498644 CTCAGTTTGTGTTTGTCTGATGG + Intergenic
976791603 4:88885106-88885128 AACAATTGGTGGTATTTTGATGG - Intronic
977365482 4:96063024-96063046 AATGGTTTCTGGTAGTCTAAGGG + Intergenic
978676408 4:111324302-111324324 CACAGTGTGTGGTGGTGTGAGGG + Intergenic
979653586 4:123164927-123164949 AAGAGTTTGTTGAAGTTTGAAGG + Intronic
980215178 4:129843551-129843573 CATAGTTTGTGGTTTTCTGAGGG - Intergenic
982278471 4:153660424-153660446 AACAGATTCTGGTGGTTTGAAGG + Intergenic
983287395 4:165756967-165756989 AACAGATTGATGTAGTCTGATGG + Intergenic
1202756533 4_GL000008v2_random:68386-68408 CAAAATTTGTGGAAGTCTGATGG + Intergenic
986618196 5:9641795-9641817 AACAGTTTGTTTTAGTGAGAAGG + Intronic
986872690 5:12068523-12068545 AACTGTTTATGGTAGTTTGGAGG + Intergenic
988295673 5:29357616-29357638 CACATTTTTGGGTAGTCTGATGG - Intergenic
991977726 5:72199457-72199479 AACAGTATGTGGAAGTATCAGGG - Exonic
1003985820 6:11434183-11434205 AACAGATTGTAATATTCTGAAGG + Intergenic
1005788607 6:29273186-29273208 CACTGTTAGTGTTAGTCTGATGG - Intergenic
1011161130 6:84391451-84391473 CACAGGCTGTGGTAGTCTCATGG + Intergenic
1012687230 6:102267178-102267200 GACAGTCTTTGGTAGTTTGATGG - Intergenic
1013509103 6:110828508-110828530 AACAGTTTGTCCAAGTCTAAAGG + Intronic
1013693738 6:112675889-112675911 GAAAGTTAGTGGTAGTCTGATGG - Intergenic
1016478217 6:144451849-144451871 AATAGTTTGTTGTATTCCGAAGG - Intronic
1016982032 6:149863095-149863117 AAAAGTTTGTTTTAGTCTCATGG - Intronic
1018257507 6:161936512-161936534 AACAGTTTTTGGGAGGCTCAAGG + Intronic
1023588154 7:41752237-41752259 AACATTTTGTGGGAATATGATGG + Intergenic
1025275457 7:57578687-57578709 AACAGTTTTTGGTTGGATGAAGG - Intergenic
1026848978 7:73713136-73713158 TTCAGTTTGTGGGATTCTGATGG + Intronic
1027997156 7:85438821-85438843 GACAGTTGATGGTAATCTGATGG + Intergenic
1028540648 7:91939527-91939549 TTCAGTTTGTGGTAGACTTAAGG + Intergenic
1028805127 7:95017218-95017240 AGCAGTTTGTGGTACTCTCTGGG + Intronic
1031842678 7:126764846-126764868 ATGAGTTTGTGTTAGCCTGAGGG - Intronic
1032496061 7:132363759-132363781 AACAGATGGTGGCAGTATGATGG - Intronic
1032752050 7:134851283-134851305 AACAGTTAGTGGCAGTTTTATGG + Intronic
1033223812 7:139545450-139545472 AAGAGTTTGTGAAAGTCTTATGG + Intergenic
1033800019 7:144889857-144889879 TATAGTTTGTGGTAGTTTGATGG + Intergenic
1037911923 8:22748690-22748712 AACAGCTTTTGGTAGTCTTGGGG + Intronic
1038859889 8:31375637-31375659 AACAGTTAGGAGTAGTCTGCTGG + Intergenic
1039796923 8:40923653-40923675 AAGAGTCTGTGGTTGTATGAAGG - Intergenic
1040804565 8:51379365-51379387 AAAAATTTTTGGTAATCTGAGGG + Intronic
1042884717 8:73535812-73535834 AAGAGTTTGTATTAGTTTGATGG - Intronic
1043314061 8:78898020-78898042 AAGAGTTTGTTGTAGTTTAATGG + Intergenic
1044835621 8:96292801-96292823 AGCAGCTTGTGGTTGTCTAATGG - Intronic
1045298051 8:100889366-100889388 AACAGATTCTGGAAGGCTGAGGG + Intergenic
1046474854 8:114728961-114728983 AACAGTCAGTGATAGTCAGAGGG + Intergenic
1048882523 8:138882601-138882623 AAGAGTGTGTGGGAGTGTGAGGG - Intronic
1050511592 9:6402021-6402043 AATAATTTGTGGTAGACTGAGGG + Intergenic
1050935510 9:11390021-11390043 AACAATTTTTGCTAGTTTGAGGG + Intergenic
1056091065 9:83206814-83206836 AACAGCTTCTGGAAGCCTGAAGG - Intergenic
1057632492 9:96731780-96731802 AATAGTCTGAGGTAGTCTGAGGG + Intergenic
1057784182 9:98074281-98074303 CAAAGTCTGTGGGAGTCTGAAGG - Intronic
1203688140 Un_GL000214v1:15463-15485 TAAAATTTGTGGAAGTCTGATGG + Intergenic
1203754486 Un_GL000218v1:112280-112302 TAAAATTTGTGGAAGTCTGATGG - Intergenic
1203713866 Un_KI270742v1:124782-124804 TAAAATTTGTGGAAGTCTGATGG - Intergenic
1203537329 Un_KI270743v1:53243-53265 TAAAATTTGTGGAAGTCTGATGG + Intergenic
1203648135 Un_KI270751v1:88590-88612 TAAAATTTGTGGAAGTCTGATGG - Intergenic
1186057140 X:5661769-5661791 AACAGATTGTGGTGGGCTAAGGG + Intergenic
1191794734 X:65009197-65009219 AAGAGCTTGTGGGAGTCTGCAGG - Intronic
1192932589 X:75824014-75824036 AGCAGTTAGTGGTAGGCTGTGGG + Intergenic
1193163497 X:78256588-78256610 AAGAGTTGGTGGTAGTCACAGGG - Intergenic
1193394144 X:80964081-80964103 AAAAGTTAGTGGTAGCTTGATGG + Intergenic
1201168117 Y:11229925-11229947 TAAAATTTGTGGAAGTCTGATGG - Intergenic
1201965921 Y:19735586-19735608 AACAGATTGGGGAAGTGTGAGGG - Intronic