ID: 901549654

View in Genome Browser
Species Human (GRCh38)
Location 1:9986486-9986508
Sequence CTTTGGAAGGCCAAGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 274879
Summary {0: 52, 1: 2206, 2: 28156, 3: 83347, 4: 161118}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901549647_901549654 11 Left 901549647 1:9986452-9986474 CCAGGCTTGGTGGCTCACATCTG 0: 32
1: 1127
2: 15243
3: 58652
4: 140531
Right 901549654 1:9986486-9986508 CTTTGGAAGGCCAAGGTGGAAGG 0: 52
1: 2206
2: 28156
3: 83347
4: 161118
901549644_901549654 28 Left 901549644 1:9986435-9986457 CCGGCGTGGTGGCTCAGCCAGGC 0: 1
1: 0
2: 0
3: 15
4: 270
Right 901549654 1:9986486-9986508 CTTTGGAAGGCCAAGGTGGAAGG 0: 52
1: 2206
2: 28156
3: 83347
4: 161118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901549654 Original CRISPR CTTTGGAAGGCCAAGGTGGA AGG Intergenic
Too many off-targets to display for this crispr