ID: 901553560

View in Genome Browser
Species Human (GRCh38)
Location 1:10014122-10014144
Sequence AACTTTCAGCCTCATCCCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 208}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901553556_901553560 9 Left 901553556 1:10014090-10014112 CCAGAAAATCGAAGGCATGATTA 0: 1
1: 0
2: 6
3: 64
4: 281
Right 901553560 1:10014122-10014144 AACTTTCAGCCTCATCCCTGAGG 0: 1
1: 0
2: 1
3: 21
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901553560 Original CRISPR AACTTTCAGCCTCATCCCTG AGG Intronic
901553560 1:10014122-10014144 AACTTTCAGCCTCATCCCTGAGG + Intronic
901732468 1:11290199-11290221 AATTTTCAGCCACCTGCCTGGGG - Intronic
903604629 1:24566693-24566715 AGCCTCCAGCCTCTTCCCTGGGG - Intronic
905755438 1:40505470-40505492 AACTTTCAGCCTAAAGACTGTGG - Intergenic
906795823 1:48695778-48695800 AACTTTAAGCCACATCCCCAAGG + Intronic
908343696 1:63209182-63209204 TACTGTCTGCCTCATCCCTTCGG - Intergenic
908745539 1:67372762-67372784 AACTCCCAGCCTCAGCTCTGTGG + Exonic
911751771 1:101504008-101504030 TACTTTAAGCCTCTTCCCTCAGG + Intergenic
912173602 1:107130824-107130846 AAATTTCAGACTCTTCACTGGGG + Intergenic
914434437 1:147647813-147647835 AACCAACAGGCTCATCCCTGGGG + Intronic
918080441 1:181203851-181203873 AAATGTCAGCCTCCTTCCTGAGG - Intergenic
919553026 1:199015943-199015965 AACTTTCACCTTCCACCCTGTGG + Intergenic
920341856 1:205280059-205280081 CATCTTCAGCCTCACCCCTGGGG - Intergenic
920438612 1:205963954-205963976 AACTTCCAGCGGCAACCCTGGGG - Intergenic
921159194 1:212461129-212461151 AACTTTTAGCCACAACCGTGAGG - Intergenic
1062881710 10:984004-984026 AATTTTAAGCCTCCTCCCTCTGG + Intergenic
1062906866 10:1185187-1185209 AATTTGCAGCCTCCGCCCTGCGG - Intronic
1064805757 10:19129563-19129585 AACTTTCAGCCCCACCTCTTTGG - Intronic
1065135313 10:22661862-22661884 AATTTTCAGCCTCTTCTCTCTGG - Intronic
1065855427 10:29826394-29826416 AACTTGAAGCCTAAACCCTGGGG + Intergenic
1066501166 10:35996215-35996237 AACTTACACCATCATCCCTCTGG - Intergenic
1066629034 10:37440483-37440505 AACTTACACCATCATCCCTCTGG - Intergenic
1067778954 10:49184812-49184834 AACTTGCAGCCTGATGGCTGAGG - Intronic
1069375670 10:67789927-67789949 AACTTTCAGCCTTACCCCCCAGG - Intergenic
1071741569 10:88364263-88364285 AAGTTTCCCCCTCATCCTTGAGG - Intronic
1072316005 10:94203909-94203931 AACTTTCAGACTAAAACCTGAGG - Intronic
1072434337 10:95401701-95401723 AACTTTCATTCTCCTCCATGGGG + Intronic
1073600807 10:104844300-104844322 TACTTTAAGCCTCATTCCTGTGG + Intronic
1074664599 10:115705785-115705807 TACTTTCTGCATAATCCCTGTGG - Intronic
1075825194 10:125350355-125350377 AGTTTTCAGCTTCATGCCTGGGG - Intergenic
1076728238 10:132423789-132423811 TTCTTTCAGGCTCACCCCTGGGG + Intergenic
1078234722 11:9473546-9473568 ATCTGTCATTCTCATCCCTGAGG - Intronic
1078894651 11:15587251-15587273 AAATCTCAGCATCAGCCCTGTGG - Intergenic
1078916306 11:15781890-15781912 AGTCTTAAGCCTCATCCCTGGGG - Intergenic
1080067636 11:28037719-28037741 TACTTTCACCCTCATCACTCTGG + Intronic
1080384597 11:31803815-31803837 ATCTCACAACCTCATCCCTGTGG + Intronic
1080399364 11:31919963-31919985 AGTTTTCAGCCTCTTCCCTGGGG + Intronic
1081864234 11:46350947-46350969 AACTATCAGTCTCCTCCCTGAGG + Intronic
1084586959 11:70067936-70067958 GACTATCAGCCTCACACCTGCGG + Intergenic
1087528190 11:99345452-99345474 AACTTATGCCCTCATCCCTGTGG + Intronic
1088109374 11:106244911-106244933 AACTTTCAGCCTCACTTTTGGGG - Intergenic
1089199695 11:116716636-116716658 AAATTTGAGCTTCCTCCCTGGGG + Intergenic
1089413978 11:118271618-118271640 GATTTTCAGCCTCATCTCTGAGG - Intergenic
1089589464 11:119531261-119531283 TACTTTCGGCCTCATCCTGGGGG - Intergenic
1090345526 11:126066403-126066425 ACCTTCCCACCTCATCCCTGAGG - Intergenic
1090858732 11:130634319-130634341 AACTGAGAGCCTCCTCCCTGGGG - Intergenic
1091275356 11:134346073-134346095 AAGGATCAGCCTCTTCCCTGAGG - Intronic
1092383323 12:8016341-8016363 AACGTTCAGCCTCATGACTTAGG + Intergenic
1092436713 12:8453383-8453405 AACTTTCAGCCCCACTCCTCCGG - Intergenic
1093871304 12:24294792-24294814 CACTGTCGGCTTCATCCCTGTGG - Intergenic
1095691354 12:45093053-45093075 ACCTTCCATGCTCATCCCTGAGG + Intergenic
1097035466 12:56120897-56120919 TACTTTCTGCCTCAGCCGTGGGG - Exonic
1098812871 12:75118459-75118481 AAATTTCAACCTCATTGCTGAGG + Intronic
1101182109 12:102230433-102230455 AGATTTCAGCATCATCACTGTGG - Intergenic
1101821880 12:108190751-108190773 GCCTCTCAGCCTCCTCCCTGTGG + Intronic
1103138509 12:118528236-118528258 TAATTTCAGCCTCATCTATGGGG - Intergenic
1103517433 12:121516504-121516526 AGGTTTCAGCCACATGCCTGGGG + Intronic
1104113097 12:125722638-125722660 TACTTTCAGCCTAATCCCACAGG + Intergenic
1107496318 13:40929013-40929035 AACTTTCAGTCCCATCCCCAAGG + Intergenic
1108515383 13:51196930-51196952 AAGTTTCAGCAGCATCCCTGAGG - Intergenic
1108562394 13:51658508-51658530 AACTGTCAGCCCCATCCCTACGG - Intronic
1111323064 13:86655744-86655766 GACTTTCTGGCTCATGCCTGAGG + Intergenic
1111848008 13:93535914-93535936 AACATACAGGCTCATCACTGAGG - Intronic
1113625128 13:111789345-111789367 AGCCTTCAGCCTCAGCGCTGTGG - Intergenic
1115144694 14:30212814-30212836 AACCTTCTGCCTCATTCCAGGGG - Intergenic
1115358053 14:32470541-32470563 ATCTGTCAGCTTCATCTCTGGGG + Intronic
1117435841 14:55714549-55714571 GTCTTTCTGCCTCCTCCCTGCGG + Intergenic
1118198482 14:63650256-63650278 AACTTTCTGCCTCATTCCACTGG + Intergenic
1119484562 14:74979348-74979370 AGCTTTCAGCCTCTTCCCTGGGG + Intergenic
1120069388 14:80085830-80085852 AACTTTCAGCCTCACCCACAAGG - Intergenic
1120659675 14:87236632-87236654 TATTTTCTGCCTCATTCCTGAGG - Intergenic
1121993397 14:98582924-98582946 GAGTTTCAGCCTCATTCCTGGGG - Intergenic
1125008007 15:34839604-34839626 ATCTTACAGCCTGATCCCTCTGG + Intergenic
1125531872 15:40418805-40418827 AACTTTCAGTCTCTTTTCTGGGG + Intronic
1126103647 15:45134408-45134430 ACCTCTCACCCTCATCCCTTAGG - Intronic
1127813488 15:62585166-62585188 AACTTACACCCACATTCCTGTGG + Intronic
1127903872 15:63361572-63361594 ACCTTCCAGTCTCTTCCCTGTGG - Intronic
1129910331 15:79221347-79221369 AACTTACAGCCAAAGCCCTGAGG + Intergenic
1130997689 15:88912984-88913006 ATCTGTAAGCCGCATCCCTGGGG + Intronic
1133033608 16:3022943-3022965 TCCTGGCAGCCTCATCCCTGAGG - Exonic
1133922733 16:10168519-10168541 AATTTTCCACCTCATTCCTGAGG + Intronic
1134282931 16:12833974-12833996 GCCTTTCAGCCTCATCTCTGCGG + Intergenic
1137275675 16:46931899-46931921 AACAAACAGCCTCTTCCCTGGGG + Intergenic
1137379756 16:47986458-47986480 AAGCTTCAGCCTGATCCCTCAGG + Intergenic
1140877742 16:79168698-79168720 AGCTTTCCTCCTCTTCCCTGAGG - Intronic
1144185521 17:12791653-12791675 ATTTTTCAGCCTCATCCATGGGG + Intronic
1144248322 17:13390458-13390480 AATTTTCAAAATCATCCCTGGGG + Intergenic
1144318641 17:14090074-14090096 CACTTTCAGCCTGACACCTGGGG + Intronic
1144889364 17:18485095-18485117 GACCTTCAGCTTCATTCCTGTGG - Intronic
1145142846 17:20459201-20459223 GACCTTCAGCTTCATTCCTGTGG + Intronic
1147667293 17:42156691-42156713 AAGTTTCTTCCTCAACCCTGGGG + Intergenic
1148824313 17:50380947-50380969 GCTTTTCATCCTCATCCCTGAGG - Exonic
1148945369 17:51258709-51258731 AAATTTCAGCGTCATCTCCGTGG - Intronic
1150619411 17:66798063-66798085 ACCTGCCTGCCTCATCCCTGAGG + Intronic
1152351561 17:79786437-79786459 ATCTGTCAGCCTCGGCCCTGAGG + Exonic
1153131580 18:1860072-1860094 CACTCTCAACCTCATCTCTGGGG + Intergenic
1153307821 18:3648883-3648905 ACCCTTCACCCTCCTCCCTGGGG - Intronic
1153336220 18:3928362-3928384 AACTTTCAGCATAATTACTGAGG - Intronic
1155495633 18:26439172-26439194 AACTATCAGCCTTAGCTCTGTGG - Intergenic
1155834964 18:30569489-30569511 GACTTTGATCCTCATCCCTGAGG - Intergenic
1158407458 18:57172858-57172880 TACTTGCAACCTCATCCATGTGG + Intergenic
1158407711 18:57175010-57175032 TACTTGCAACCTCATCCATGTGG + Intergenic
1158925559 18:62254977-62254999 AACTTCCTTCCTCATCCCTTAGG + Intronic
1160303237 18:77705476-77705498 AAGTTTCACCCTCACCCATGTGG + Intergenic
1161783233 19:6307366-6307388 ACCTCTGAGCCTCATCACTGTGG - Intronic
1162708074 19:12570821-12570843 AACTTTCAGCTCCATTCCTTTGG - Intronic
1162854869 19:13460515-13460537 AAATTTCAGCCTAATGCATGTGG + Intronic
1163102169 19:15104700-15104722 GACTTCCAGCCTCATCTCTTTGG - Intergenic
1166347333 19:42174925-42174947 CACTTTCTGCCTCCTTCCTGGGG - Intronic
1166536186 19:43576396-43576418 CTCTTTCAGCCTTATGCCTGAGG + Intronic
1166948879 19:46413365-46413387 AAGTTCCAGCCGCGTCCCTGGGG - Exonic
1168586705 19:57599887-57599909 AACTTCCGGCGTCCTCCCTGTGG + Exonic
1168706809 19:58475023-58475045 AACTTTCACCCTCCACCATGTGG - Intronic
1202646441 1_KI270706v1_random:146282-146304 AACTGTCAGCCTCACCCCCTGGG + Intergenic
925188228 2:1864052-1864074 AACCTGCAGCCGCAGCCCTGGGG - Intronic
929302421 2:40321010-40321032 AGTTTACAGCCTCTTCCCTGTGG - Intronic
934122668 2:88855322-88855344 AACTTGCTCACTCATCCCTGGGG - Intergenic
935861568 2:107336852-107336874 AACTTTCAGCCCTTTCCTTGCGG + Intergenic
937270032 2:120643798-120643820 ACCCTTCACCCTTATCCCTGGGG + Intergenic
937677400 2:124607334-124607356 AACTTCCAGGCTCACTCCTGTGG + Intronic
941978217 2:171428920-171428942 CATTTTCAGCCTCATCTCTTTGG - Intronic
944042572 2:195372980-195373002 AACTTTCCACCTAATCCATGAGG - Intergenic
945321729 2:208432282-208432304 AAGTTTCTGCCTTTTCCCTGTGG + Intronic
947061643 2:226172910-226172932 ATCTATCAGCCTCAAACCTGTGG - Intergenic
948163880 2:235845987-235846009 AAATTTAAGCCTCATCCAGGAGG - Intronic
1169570978 20:6904835-6904857 AACTTTCAGCCCTTTCCCTTTGG + Intergenic
1171003868 20:21443905-21443927 AGTGTTAAGCCTCATCCCTGGGG + Intergenic
1173759081 20:45544030-45544052 TATCTTCAGTCTCATCCCTGAGG + Intronic
1176094860 20:63335969-63335991 CACTGTCAGCTACATCCCTGTGG + Intergenic
1179306270 21:40156169-40156191 GGCTCTCAGCCTCATCCCTGTGG - Intronic
1179497275 21:41780523-41780545 GACTTCCAGCCCCCTCCCTGTGG - Intergenic
1179960678 21:44765572-44765594 AGCATTCAGCCCCATCTCTGTGG - Intergenic
1180347725 22:11718080-11718102 AACTGTCAGCCTCACCCCCTGGG - Intergenic
1180355500 22:11836185-11836207 AACTGTCAGCCTCACCCCCTGGG - Intergenic
1180382752 22:12156140-12156162 AACTGTCAGCCTCACCCCCTGGG + Intergenic
1182345186 22:29658183-29658205 CCATTTCAGCTTCATCCCTGTGG - Exonic
1184201690 22:42973876-42973898 AAATGGCAGCCTCATCCTTGGGG + Intronic
1184252869 22:43270878-43270900 AACTTTCAGCCTAACCCTTTGGG - Intronic
950162604 3:10771646-10771668 AGGTTTCAACATCATCCCTGAGG + Intergenic
952822833 3:37499671-37499693 TCCCTTCAGCCTCAGCCCTGAGG + Intronic
952994606 3:38867145-38867167 TTCTTTCAGCCTCATCTTTGAGG + Intronic
953199638 3:40767415-40767437 AACTTTCAGCCACTTTCATGGGG + Intergenic
956215285 3:66842481-66842503 AAGTTTCAGCCAGATCCCAGTGG - Intergenic
957009269 3:74985683-74985705 ACCTCTCAGCTTCATCCCAGGGG + Intergenic
957707911 3:83813780-83813802 AAGTTTCAGCCTCATTGCTGAGG + Intergenic
958058826 3:88450580-88450602 GTCCTTCAGGCTCATCCCTGTGG + Intergenic
964495448 3:157284969-157284991 AACTTTCAGCCCCTTTTCTGAGG + Intronic
966655945 3:182358899-182358921 AAATTTGGGCCCCATCCCTGAGG - Intergenic
968285106 3:197503991-197504013 CACTTTCAGGCTCATCCTAGAGG - Intergenic
968927373 4:3556663-3556685 ATCTCCCAGCCTCCTCCCTGAGG + Intergenic
971848150 4:31946685-31946707 AGCGTTCAGCCCCACCCCTGTGG - Intergenic
972135710 4:35890719-35890741 CACTTTCACCCTCATGCCAGTGG + Intergenic
973372670 4:49264429-49264451 AACTGTCAGCCTCACCCCCTGGG + Intergenic
973388322 4:49530631-49530653 AACTGTCAGCCTCACCCCCTGGG - Intergenic
973634596 4:52850339-52850361 GACTTTCAGCCTCTTCCCCATGG - Intergenic
974123940 4:57672665-57672687 AACTATCATCCTTATGCCTGAGG - Intergenic
974583127 4:63832999-63833021 AATTTTCAGTCTCTTGCCTGAGG - Intergenic
975077158 4:70224822-70224844 ACCTGTCATCCCCATCCCTGGGG + Intergenic
975675600 4:76824450-76824472 AACTGTCAGCCTCTGCCATGAGG - Intergenic
979377365 4:119962893-119962915 AACTCTCAGTCTCATCACTGAGG + Intergenic
979381065 4:120007271-120007293 AACTCTCAGTCTCATCACTGAGG - Intergenic
979564906 4:122144270-122144292 AACTTTCTACCTCCTCCTTGAGG + Intergenic
982448551 4:155524176-155524198 TCCTTTAAGCCTCATCTCTGAGG + Intergenic
983709156 4:170693142-170693164 GACTTTCAGCCCCACCCCTCAGG - Intergenic
984014390 4:174408516-174408538 TACTTTCAGTCTGATCCCTTGGG + Intergenic
987378033 5:17255676-17255698 AACATTCAGAATCATCACTGAGG + Intronic
988264218 5:28928430-28928452 TGCGCTCAGCCTCATCCCTGTGG - Intergenic
988450188 5:31334192-31334214 AACTTCCCTCCTCATCCCTTAGG - Intergenic
989720837 5:44526048-44526070 AATTTACAGGCTCATTCCTGTGG - Intergenic
991371461 5:65925122-65925144 AAGTCTCAGCCTCATACCGGCGG - Intergenic
991410291 5:66339004-66339026 AAATTTCAGCCTCTTTCTTGGGG + Intergenic
992592395 5:78308867-78308889 AACACTCAGCCTAATCACTGTGG - Intergenic
993971385 5:94423709-94423731 GTCTTTCAGCCTCCTCCCTTTGG - Intronic
999296261 5:150461353-150461375 AAATTACAGCCCCATCCCTGAGG - Intergenic
999948675 5:156625147-156625169 AACTTTCTGCATCATTCCTATGG - Intronic
1004736392 6:18410446-18410468 ATCTTTCAGTCTCAGCCCTTAGG - Intronic
1006028479 6:31162287-31162309 AACTTTCAGGCTCATACTAGAGG + Intronic
1007503008 6:42312973-42312995 AGCTTGCAGCCTCGACCCTGGGG + Intronic
1009737685 6:67698787-67698809 AACTTTCAGTATTATTCCTGTGG - Intergenic
1013270835 6:108544142-108544164 AACCTTGGGTCTCATCCCTGAGG + Intergenic
1014257578 6:119178341-119178363 ATGTTTCAGCCTAATCCATGGGG + Exonic
1015997129 6:139006760-139006782 AACTTTCAGACTGCTCCCTGTGG + Intergenic
1017989947 6:159477899-159477921 GACTGTCAGCCTCATCAGTGTGG - Intergenic
1018562353 6:165115002-165115024 AACTTTGTGCCTCATACCAGAGG + Intergenic
1018648819 6:165973646-165973668 ATCTGTCTGCCTCTTCCCTGGGG - Intronic
1018791090 6:167148312-167148334 AACTGGCAGCCACATCCCAGGGG + Intronic
1019729370 7:2622065-2622087 AACTATCAGCCTCCTTCCAGAGG + Intergenic
1019820181 7:3236862-3236884 AACTAACAGCCTGGTCCCTGGGG + Intergenic
1021235913 7:18142389-18142411 AATTTTCATTCTTATCCCTGAGG + Intronic
1023821424 7:43982787-43982809 AGCTTTGAGCCCCAACCCTGGGG - Intergenic
1023847157 7:44128810-44128832 AACTCTCTGCTTCCTCCCTGAGG - Intergenic
1025780814 7:64600324-64600346 ATCTTTCACAATCATCCCTGTGG - Intergenic
1027643925 7:80772500-80772522 CACCTTCAGCCTCAGCCCTGGGG + Intronic
1030418775 7:109280445-109280467 AGCTTTCAGTCTCGTCCCTAGGG - Intergenic
1031752061 7:125588004-125588026 AATTTTCTGCCTCATATCTGGGG - Intergenic
1036513512 8:9422134-9422156 ATCTTTCATTCTCTTCCCTGGGG - Intergenic
1036680398 8:10868366-10868388 AACTGGCAGCCACCTCCCTGAGG - Intergenic
1038970036 8:32622954-32622976 AACTGTCAGCATCATCACTTAGG - Intronic
1039013785 8:33124102-33124124 AACTTTCAGCCCCATCCTCTGGG - Intergenic
1041104403 8:54427215-54427237 AAATTTCAGCCTCTTGCCTGAGG - Intergenic
1041919710 8:63168402-63168424 AACTTTCAGCGTCTTTTCTGCGG - Intergenic
1042207644 8:66345196-66345218 CATTTTCAGCTTCATTCCTGTGG + Intergenic
1043185616 8:77145016-77145038 TCCTTTCATCCTCATCCATGAGG - Intergenic
1044620672 8:94188023-94188045 AGCTTTCAGCCTCTCCTCTGTGG + Intronic
1045268954 8:100645421-100645443 AACTTTCAGCCTCAGACTTAGGG + Intronic
1045925553 8:107576334-107576356 TAATATCAGCCTCTTCCCTGTGG - Intergenic
1048600201 8:135911599-135911621 AACTTTTAGCTTCTTCCTTGAGG + Intergenic
1049228232 8:141467875-141467897 ATCTGCCAGCCTCAGCCCTGTGG + Intergenic
1053715700 9:40885184-40885206 GACTCTCAGCCCCATCCCTATGG - Intergenic
1054734745 9:68739546-68739568 AAATTTCAGCCTCCTTCTTGGGG + Intronic
1054887336 9:70212814-70212836 TAGTTTCAGCCTGATACCTGTGG + Intronic
1056318481 9:85414613-85414635 AACTGTCAGCCCCATTGCTGGGG + Intergenic
1056606993 9:88093985-88094007 ACTTTTTAGTCTCATCCCTGAGG + Intergenic
1056678177 9:88694663-88694685 AAGATTCAGCCTATTCCCTGGGG + Intergenic
1058142187 9:101368538-101368560 CACTTTCAGCCTTCTACCTGGGG + Intronic
1058293673 9:103277516-103277538 AACTTTCATTCTCATCCTTGAGG + Intergenic
1059446934 9:114343821-114343843 AACTGTCAGTATCAGCCCTGTGG + Intronic
1061007365 9:127935694-127935716 GGCTGGCAGCCTCATCCCTGCGG + Exonic
1061417255 9:130453802-130453824 AACTTCCAGCTCCGTCCCTGTGG - Intronic
1061557329 9:131379126-131379148 GCCTTTCAGCTTCATCCATGTGG + Intergenic
1061884385 9:133584236-133584258 TACCTTCAGCCTCCTCCCTGGGG + Intronic
1062714526 9:138000519-138000541 ATCTTTCTGCCTCCTGCCTGGGG + Intronic
1203552831 Un_KI270743v1:178567-178589 AACTGTCAGCCTCACCCCCTGGG - Intergenic
1187479739 X:19644179-19644201 AACTGTCTGCCTACTCCCTGTGG - Intronic
1188355702 X:29188116-29188138 TACTTACAGCCTCAACCATGTGG + Intronic
1191740520 X:64432507-64432529 CCCCATCAGCCTCATCCCTGGGG + Intergenic
1192177127 X:68893131-68893153 CACTTGCAGCCTCATCTCTGGGG + Intergenic
1192911183 X:75606129-75606151 AACCTTCAGGCTCAACCCTAGGG - Intergenic
1193210315 X:78800086-78800108 AACATTCAGCTTCACACCTGTGG - Intergenic
1196111702 X:111953575-111953597 CACTTTTCCCCTCATCCCTGAGG + Intronic
1197125286 X:122938808-122938830 AACCTTCATCCTCTTCCATGAGG - Intergenic