ID: 901559584

View in Genome Browser
Species Human (GRCh38)
Location 1:10059479-10059501
Sequence CCTTCCGGGAGAGCCTCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 155}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901559584_901559592 7 Left 901559584 1:10059479-10059501 CCTTGGGAGGCTCTCCCGGAAGG 0: 1
1: 0
2: 1
3: 26
4: 155
Right 901559592 1:10059509-10059531 ATGGAGCTGAGCCTGCCCACTGG 0: 1
1: 2
2: 9
3: 36
4: 278

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901559584 Original CRISPR CCTTCCGGGAGAGCCTCCCA AGG (reversed) Intronic