ID: 901559744

View in Genome Browser
Species Human (GRCh38)
Location 1:10060618-10060640
Sequence TGGCTACTAGAACCCCAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 131}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901559744_901559746 -2 Left 901559744 1:10060618-10060640 CCTTTCTGGGGTTCTAGTAGCCA 0: 1
1: 0
2: 1
3: 8
4: 131
Right 901559746 1:10060639-10060661 CATTGAAGTACTCCTAAGTGTGG 0: 1
1: 0
2: 0
3: 6
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901559744 Original CRISPR TGGCTACTAGAACCCCAGAA AGG (reversed) Intronic
901559744 1:10060618-10060640 TGGCTACTAGAACCCCAGAAAGG - Intronic
907422101 1:54354473-54354495 TGGATCCTAGAGCCCCAGGAGGG + Intronic
908446643 1:64203915-64203937 TGCTTTCTAGAACCTCAGAACGG - Exonic
910895956 1:92069568-92069590 ATGCTACTAGAACCCTAGAAGGG + Intergenic
911319877 1:96400637-96400659 TGGCTACCAGAAGCCAGGAAGGG + Intergenic
915366885 1:155321732-155321754 TGGCTTCTAGAGAACCAGAAGGG - Exonic
916429635 1:164714800-164714822 AGGGTATTAGAACCCAAGAAAGG + Intronic
919765255 1:201123064-201123086 TGGCTAAGAGAAGCCCAGGACGG + Intronic
919970165 1:202571172-202571194 GGGCAACTAGAACCACTGAAGGG - Intronic
1062884186 10:1004235-1004257 TGGCAGCAAGGACCCCAGAATGG + Intronic
1064577279 10:16759037-16759059 TGTCTTCTAAAGCCCCAGAAAGG + Intronic
1069100883 10:64318975-64318997 TGGCTAATAGAACCAGAAAACGG - Intergenic
1069329639 10:67277266-67277288 TGGCTCCCAGTACACCAGAAAGG + Intronic
1069410208 10:68145598-68145620 TGGTTACTAGAACTTAAGAAGGG + Intronic
1071905167 10:90165115-90165137 TGGTTACCAGAAGCCAAGAAGGG - Intergenic
1072771784 10:98146474-98146496 TGGGTACCAGAAGCCAAGAAGGG - Intronic
1072883199 10:99248846-99248868 TGGCTAAAAGAGCCCCAGATAGG + Intergenic
1073284855 10:102381508-102381530 TCTCTACTAGAATCCCTGAAAGG - Intronic
1073686995 10:105765690-105765712 TGGCTACTAGACACCAAAAAAGG - Intergenic
1074401086 10:113141561-113141583 TGGCTTCCAGTACCCCTGAAGGG + Intronic
1075508842 10:123052273-123052295 TGTCTGCCAGAACCACAGAAAGG - Intronic
1076696818 10:132251125-132251147 TGGCTCCTAGACCCCCAGGCCGG - Intronic
1077324294 11:1957085-1957107 TGGCAGCAAGAACCCGAGAAGGG + Intronic
1078123023 11:8529753-8529775 TGGCTTCTAGAAGCTGAGAAAGG + Intronic
1078765414 11:14292215-14292237 TGCCCACTAGAACCCCAAAGAGG - Intronic
1078842461 11:15091569-15091591 TGGCAGCAAGTACCCCAGAAGGG + Intergenic
1079594453 11:22224980-22225002 TGGCTACCAGAAGCCAGGAAAGG + Intronic
1080483130 11:32673883-32673905 AGGTTACTGGAACCCCAAAAGGG + Intronic
1082906676 11:58315290-58315312 TGACTCCTAGAACATCAGAAAGG + Intergenic
1085675320 11:78511992-78512014 AGGCTCCAGGAACCCCAGAAGGG + Intronic
1086763085 11:90658511-90658533 TGGGGACAAGAACACCAGAAGGG - Intergenic
1087877894 11:103379851-103379873 TTGGTACTAGAAACACAGAAGGG - Intronic
1088602120 11:111489829-111489851 TGGTTACTAGAAGCCGGGAAGGG + Intronic
1089105181 11:115997037-115997059 TGACTTCTCGAACCCCAGGAGGG - Intergenic
1089692873 11:120197710-120197732 TGGCCTCTAGAAGCCCAGCAGGG + Intergenic
1091082074 11:132680749-132680771 TGGCTAATAGGCCCCCAGAGAGG - Intronic
1202807280 11_KI270721v1_random:12280-12302 TGGCAGCAAGAACCCGAGAAGGG + Intergenic
1093134156 12:15430055-15430077 TGCCTACTTGAACGTCAGAAAGG - Intronic
1093808390 12:23464296-23464318 TGGGTACTAGCACCCCAAACTGG + Intergenic
1094672267 12:32582010-32582032 ATGCTCCTAGAACCCCAGGAAGG + Exonic
1095366960 12:41418947-41418969 TGGCTACGAGAAGCCAAGCAGGG - Intronic
1097309994 12:58108703-58108725 TGGTTACTAGAGGCCCGGAAGGG - Intergenic
1098514521 12:71358556-71358578 TGGCAGCAAGTACCCCAGAATGG - Intronic
1099320071 12:81135664-81135686 TGGACACTGGAAACCCAGAACGG + Intronic
1102220980 12:111194249-111194271 GTGCTACAAGAACCCCAGGAGGG - Intronic
1102879794 12:116475500-116475522 TAGTTACTAGAACCCCACAGTGG + Intergenic
1103208832 12:119151870-119151892 TGGCTAATAGAATAGCAGAAGGG - Intronic
1104149700 12:126070822-126070844 TGGCTGCTAGGACACCAGATGGG + Intergenic
1108167092 13:47704860-47704882 TTGCTACTGAAACCCCAGGAAGG - Intergenic
1115124159 14:29972451-29972473 TGGCTCCTGGAACCCCAGTGGGG + Intronic
1115536525 14:34378460-34378482 TGCCTACTATAAACTCAGAATGG - Intronic
1115831784 14:37350733-37350755 TGGCTACCAGAAGCCGGGAAGGG - Intronic
1116462284 14:45191440-45191462 TGGTGATTAGAAGCCCAGAAGGG - Intronic
1121220591 14:92282110-92282132 TGGCTACTAGAAAGCCTAAATGG + Intergenic
1121772141 14:96555465-96555487 TGGCTACTATATCGCCAGAGTGG - Intronic
1123061453 14:105596586-105596608 TGGCTCTCAGGACCCCAGAATGG + Intergenic
1123085906 14:105717497-105717519 TGGCTCTCAGGACCCCAGAATGG + Intergenic
1124230388 15:27940314-27940336 TCCCTACTGGACCCCCAGAAAGG + Intronic
1125388215 15:39161735-39161757 TGGCTACAACAACCCCAGTGAGG - Intergenic
1126874517 15:53025584-53025606 TGGTTACCAGAAACCAAGAAGGG - Intergenic
1128546840 15:68574069-68574091 TGGCTGCTTGAACCCCATCAGGG - Intergenic
1134099737 16:11443614-11443636 TGCCTACTAGAACCCCATCCGGG - Intronic
1135251562 16:20904634-20904656 TGGTTACTAGAATCCAAAAAGGG - Intronic
1138120945 16:54400695-54400717 TGGATCCTAGACTCCCAGAAAGG - Intergenic
1138455644 16:57119217-57119239 TGGCTTATAAAACTCCAGAAAGG - Exonic
1139435820 16:66935878-66935900 GGGCTCCTAGAAGCACAGAAAGG + Intronic
1150248490 17:63693091-63693113 TGGCCTCTAGAACCCAGGAAAGG + Intronic
1153188786 18:2515608-2515630 TGGGTATTAGATGCCCAGAAAGG + Intergenic
1157866276 18:51188086-51188108 AGGCCACTTGAACCCTAGAAAGG - Intronic
1167274382 19:48527720-48527742 TGGCTGCTTGGACCCCAAAAGGG + Intergenic
925493827 2:4424213-4424235 TGGCTACTAGAACCCCTGGAGGG + Intergenic
931898370 2:66759438-66759460 TGGTTACCAGAAGCCAAGAAGGG + Intergenic
934989583 2:98911866-98911888 TGGCTACGGGAAACCCACAAAGG + Intronic
935112952 2:100108559-100108581 TGGCTTCTAGGGCCCCAGAAAGG - Intronic
940378303 2:152983483-152983505 TGGCTACGAGAATACCAGATTGG + Intergenic
940677769 2:156746234-156746256 TGGCAACTAAAACCCCAAACAGG + Intergenic
941268711 2:163397825-163397847 TGGCTAGGAGCACCCCTGAAGGG + Intergenic
941609134 2:167638852-167638874 TTGCAACTAGAATCCCAGATTGG - Intergenic
945183072 2:207111495-207111517 TGGCTGCTAGTCCCCCAGCAGGG - Intronic
946226974 2:218269441-218269463 TGGGTTCTAGAACCCCAGGAAGG - Exonic
948341826 2:237259120-237259142 TGGCCTCTAGGACCCCACAATGG + Intergenic
949036949 2:241820229-241820251 CGGCTTCCAGAACCCCAGAGAGG - Intergenic
1170104545 20:12739150-12739172 TGGCTATTTGAACCACATAAAGG - Intergenic
1176262190 20:64187715-64187737 TCACTACTAGAAGCCCAGTAAGG - Intronic
1177951279 21:27541136-27541158 TGGATATTAGAACCTCAGAAGGG + Intergenic
1179636984 21:42719002-42719024 TTCCTACTAAAACCACAGAAGGG - Intronic
1179894062 21:44351608-44351630 TGGGTAGAAGAACCCCAGAAAGG + Intronic
1182478310 22:30589080-30589102 GGAATACCAGAACCCCAGAATGG + Intronic
1184199519 22:42957166-42957188 TGCCCACTAGAACACCAGGAGGG + Intronic
1185013058 22:48326844-48326866 GGGCTGCTAAAACCCAAGAATGG + Intergenic
949095347 3:78986-79008 TGTATACTGGAACCGCAGAAAGG - Intergenic
950105773 3:10387426-10387448 GAACTTCTAGAACCCCAGAAGGG - Intronic
950395718 3:12732417-12732439 GGACTACTAGAAACGCAGAAAGG - Intergenic
951502063 3:23399635-23399657 AGGCAACTAAAACCTCAGAAAGG + Intronic
951778841 3:26340507-26340529 TGGCAGCAAGTACCCCAGAATGG + Intergenic
952708699 3:36407046-36407068 TGTTTACTACAACCCTAGAAAGG - Intronic
956554307 3:70500882-70500904 TGGGCACTAGAATTCCAGAAAGG + Intergenic
963564008 3:146904769-146904791 AGGCTAAAAGAACCACAGAATGG - Intergenic
967520591 3:190427782-190427804 TTGCTGCTAGAACTCCAAAATGG + Intergenic
967570525 3:191022747-191022769 TGGCTACTGTAACTCCAGATGGG + Intergenic
969304382 4:6317452-6317474 TGCATCATAGAACCCCAGAAAGG - Intergenic
970410677 4:15804748-15804770 TGGTTACTAGAAGCTGAGAAGGG + Intronic
973125472 4:46578552-46578574 TGGCTACTGTAATCCCAGATTGG - Intergenic
978572046 4:110148462-110148484 TGGTTACCAGAGGCCCAGAAGGG + Intronic
982811575 4:159832050-159832072 TGGCTACTTGAACCACTGAGGGG + Intergenic
983896254 4:173084829-173084851 TGGCTCCTGGAACGCCAGCAAGG - Intergenic
987675531 5:21068404-21068426 TTGCCCCTAGAACTCCAGAAAGG - Intergenic
991291890 5:65041445-65041467 TGGCTACCAGGATTCCAGAAGGG + Intergenic
993911108 5:93685842-93685864 TTGTTTCTAGAACCCCAGAAGGG - Intronic
994250843 5:97535189-97535211 TGGTTACTAGAAAACCAGAAAGG - Intergenic
995411220 5:111859246-111859268 TGGCTGCTAGACACTCAGAAAGG + Intronic
999454474 5:151703290-151703312 TGGGTACTAGAACCAGAGAGAGG - Intergenic
1000241784 5:159415579-159415601 TGACTATAAGAACTCCAGAAGGG - Intergenic
1002840897 6:905625-905647 TGGCTACAAAATCCCTAGAAAGG - Intergenic
1002896027 6:1380861-1380883 TGGCTGCTGGATCTCCAGAAAGG - Intergenic
1003787563 6:9504164-9504186 CAGCTACTAGAAGCCCTGAAAGG - Intergenic
1006241454 6:32683336-32683358 TAGATACTACAATCCCAGAAGGG + Intergenic
1011117035 6:83905564-83905586 TGGTTACTAGGACCCCAGGTAGG + Intronic
1015285906 6:131486017-131486039 TGGTGATTAGAAGCCCAGAAGGG - Intergenic
1018068127 6:160137816-160137838 GGGCTACTACAACCCCAGCAAGG - Intronic
1023200622 7:37693642-37693664 TGGCAGCAAGTACCCCAGAATGG + Intronic
1023616771 7:42028255-42028277 AGGCTCCTAGAACCCTGGAAAGG - Intronic
1026462777 7:70629515-70629537 TGGCTGCTATGACCACAGAAGGG - Intronic
1026626389 7:71996067-71996089 TGGCTAATAGAGCACCATAAAGG + Intronic
1030740146 7:113099832-113099854 TGACTGCTGGAAACCCAGAATGG + Intergenic
1032364858 7:131289250-131289272 TGTCTATTAGAAACCTAGAAGGG + Intronic
1034737257 7:153440667-153440689 TGGCTGCTAGGCCCCCAGAGAGG + Intergenic
1037464583 8:19148046-19148068 TGGCTAGTGGAGCCCCAGATGGG + Intergenic
1040982954 8:53264231-53264253 TGGCTACTAGAAACTAAAAAAGG + Intergenic
1046887909 8:119388693-119388715 TGGTTATTAGCAACCCAGAAGGG - Intergenic
1050374611 9:4958032-4958054 TGGCAACAAGTACCCCAAAATGG - Intergenic
1051164848 9:14250507-14250529 TGGCTACTACATCCCCACAGTGG + Intronic
1055659141 9:78484416-78484438 TTTCCACTAAAACCCCAGAAGGG - Intergenic
1058687629 9:107491651-107491673 TGGCAACTAGAACTCAAAAAGGG - Intergenic
1061981694 9:134108462-134108484 TGGTTACCAGAAGCCAAGAAGGG + Intergenic
1185666463 X:1769096-1769118 TGTCCACCAGAACCTCAGAAGGG + Intergenic
1187561504 X:20407762-20407784 AGCCTACTAAAACCCCAGACTGG - Intergenic
1197025511 X:121744311-121744333 TGGCTAATAGATGCCCAGATAGG + Intergenic
1199190852 X:144968163-144968185 TGGTTACCAGAACCTGAGAAAGG + Intergenic
1199334363 X:146600871-146600893 TGGCAACTAGAACCTGAAAACGG + Intergenic
1199793410 X:151175439-151175461 TCGAAACGAGAACCCCAGAAGGG + Intergenic