ID: 901559994

View in Genome Browser
Species Human (GRCh38)
Location 1:10062570-10062592
Sequence CGCCTGCAGCCCCAACACTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178051
Summary {0: 2, 1: 13, 2: 541, 3: 16003, 4: 161492}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901559994_901559995 -7 Left 901559994 1:10062570-10062592 CCAAAGTGTTGGGGCTGCAGGCG 0: 2
1: 13
2: 541
3: 16003
4: 161492
Right 901559995 1:10062586-10062608 GCAGGCGTAAGCCGCTGTACCGG 0: 1
1: 0
2: 1
3: 77
4: 836

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901559994 Original CRISPR CGCCTGCAGCCCCAACACTT TGG (reversed) Intronic
Too many off-targets to display for this crispr