ID: 901560767

View in Genome Browser
Species Human (GRCh38)
Location 1:10068576-10068598
Sequence CAGGCAGATGGCCCGAGGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 47281
Summary {0: 2, 1: 18, 2: 697, 3: 11444, 4: 35120}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901560767_901560779 27 Left 901560767 1:10068576-10068598 CCTGACCTCGGGCCATCTGCCTG 0: 2
1: 18
2: 697
3: 11444
4: 35120
Right 901560779 1:10068626-10068648 CAGGCATGAGCCACTGTGCCCGG 0: 7444
1: 30963
2: 79445
3: 137491
4: 151300
901560767_901560772 -1 Left 901560767 1:10068576-10068598 CCTGACCTCGGGCCATCTGCCTG 0: 2
1: 18
2: 697
3: 11444
4: 35120
Right 901560772 1:10068598-10068620 GCCTTGGCCTCCCAAAGTGCTGG 0: 52775
1: 164492
2: 216668
3: 175886
4: 111238
901560767_901560776 8 Left 901560767 1:10068576-10068598 CCTGACCTCGGGCCATCTGCCTG 0: 2
1: 18
2: 697
3: 11444
4: 35120
Right 901560776 1:10068607-10068629 TCCCAAAGTGCTGGGATTACAGG 0: 284556
1: 262309
2: 153276
3: 130613
4: 189623
901560767_901560774 0 Left 901560767 1:10068576-10068598 CCTGACCTCGGGCCATCTGCCTG 0: 2
1: 18
2: 697
3: 11444
4: 35120
Right 901560774 1:10068599-10068621 CCTTGGCCTCCCAAAGTGCTGGG 0: 84285
1: 209100
2: 236161
3: 152470
4: 88713

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901560767 Original CRISPR CAGGCAGATGGCCCGAGGTC AGG (reversed) Intronic
Too many off-targets to display for this crispr