ID: 901563305

View in Genome Browser
Species Human (GRCh38)
Location 1:10090511-10090533
Sequence CTGTAAAAGAGGAGGGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 880
Summary {0: 1, 1: 0, 2: 13, 3: 144, 4: 722}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901563301_901563305 -8 Left 901563301 1:10090496-10090518 CCTAGATATTCTTATCTGTAAAA 0: 1
1: 2
2: 17
3: 202
4: 1672
Right 901563305 1:10090511-10090533 CTGTAAAAGAGGAGGGAAGATGG 0: 1
1: 0
2: 13
3: 144
4: 722
901563300_901563305 20 Left 901563300 1:10090468-10090490 CCTAAGGGAAGTTTTTAGACTCT 0: 1
1: 0
2: 2
3: 12
4: 212
Right 901563305 1:10090511-10090533 CTGTAAAAGAGGAGGGAAGATGG 0: 1
1: 0
2: 13
3: 144
4: 722

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901563305 Original CRISPR CTGTAAAAGAGGAGGGAAGA TGG Intronic
900779946 1:4611572-4611594 CCCTAAAGGAGGAGGGAAGATGG + Intergenic
901234558 1:7661023-7661045 CTGCAAAAGTGCAGGGAGGAAGG + Intronic
901563305 1:10090511-10090533 CTGTAAAAGAGGAGGGAAGATGG + Intronic
902072572 1:13753101-13753123 CTGTGACGTAGGAGGGAAGAGGG - Intronic
903326068 1:22569266-22569288 CTGTAAAACAGGAGACAAGAGGG - Intronic
903639602 1:24849295-24849317 GGGGAAAAGAGGGGGGAAGAGGG - Intergenic
903746879 1:25593006-25593028 CTCTTAAAGAGGAGGAGAGAGGG + Intergenic
903889109 1:26557827-26557849 CTTGAAAAGAGGAGAGGAGAGGG - Intronic
904021959 1:27473514-27473536 TTGTAACAGAGGAGGAAAGAGGG + Intronic
904967109 1:34383476-34383498 TGGTAAAAGAGGAGAGAAAATGG + Intergenic
905068114 1:35201099-35201121 CTGGAAAATAGGAAGGAGGAAGG - Intergenic
905572010 1:39013549-39013571 CTTTAATGGAGGAGGGAAGTGGG + Intergenic
906008814 1:42503571-42503593 CTGGCAAAGAGAAGAGAAGATGG + Intronic
906009941 1:42513472-42513494 CTGGCAAAGAGAAGGGAAGATGG + Intronic
907674712 1:56507774-56507796 CTGTAAAAGAGGGAGGCAAAAGG + Intronic
907859546 1:58338381-58338403 CTGCAAAAGAGAAGGGAATGAGG - Intronic
907911804 1:58833729-58833751 CTGTAAAAGTGGAGGCAGGAAGG + Intergenic
908552374 1:65222243-65222265 CTGACAAAGAGAAGGGAAGATGG + Intronic
908713216 1:67041320-67041342 CTTTAAAAGAAGAGGTATGATGG + Intronic
908722897 1:67145494-67145516 CCAGAAAAGAGGTGGGAAGAGGG - Intronic
909770118 1:79411629-79411651 TTGCAAATGAGAAGGGAAGATGG + Intergenic
909988282 1:82189571-82189593 CTGGTGATGAGGAGGGAAGAGGG - Intergenic
910159874 1:84261205-84261227 TTGTAACAAAGGAGGGAAAATGG + Intergenic
911310575 1:96287938-96287960 CTCTGAAAGAGAAGGGGAGAAGG - Intergenic
911330302 1:96518981-96519003 CTGTCAAGGAGAAGAGAAGAAGG + Intergenic
911477704 1:98393830-98393852 GTGTAGAAAGGGAGGGAAGAAGG + Intergenic
912226572 1:107741020-107741042 ATGAAAAAGAGGAGAGAGGAGGG + Intronic
912819070 1:112852550-112852572 CTAGCAAAGAGAAGGGAAGATGG + Intergenic
912938348 1:114023393-114023415 CTGGAAAGGAAAAGGGAAGATGG - Intergenic
912976851 1:114338792-114338814 CTGATAAAGAGAAGGGAAGATGG + Intergenic
913409770 1:118538286-118538308 CTTTAAGAGATGAGGGAAAAGGG - Intergenic
913964258 1:143362151-143362173 ATGGAAAAGGAGAGGGAAGAAGG - Intergenic
915133263 1:153711298-153711320 CTGACAAAGAGAAGGAAAGATGG + Intergenic
915584434 1:156836611-156836633 CCATGAAAGAGGAGGGAGGAGGG - Intronic
915612430 1:157005157-157005179 CAGTAACACAGGAAGGAAGAAGG - Intronic
915912054 1:159921664-159921686 CTGGAGAAGAGAAGGCAAGACGG + Intronic
915978457 1:160405762-160405784 CTGTAAGTGAGGAAGGAGGAAGG + Intronic
916118646 1:161509372-161509394 GTGGAAAAAAGGGGGGAAGAAGG + Intronic
916336044 1:163672283-163672305 CTGACAAAGAGAAGGGAAGATGG + Intergenic
916385994 1:164270990-164271012 CTGTATCCAAGGAGGGAAGAGGG - Intergenic
916524813 1:165599574-165599596 CTTCAAAAGAGAAGGGAAGGGGG - Intergenic
917469572 1:175314920-175314942 GTAGAAAAGAGGAGAGAAGAAGG + Intergenic
917917567 1:179718871-179718893 CTCCAAAAGGGGAGGGAAGAGGG - Intergenic
918460461 1:184771342-184771364 CTGGCACAGAGAAGGGAAGATGG - Intergenic
918531848 1:185531596-185531618 CTGGAAGAGAGGAGATAAGAGGG - Intergenic
918702787 1:187626389-187626411 CTGACAAAGAGAAGGGAAGATGG + Intergenic
918834914 1:189449828-189449850 CTGACAAAGAAAAGGGAAGAGGG + Intergenic
918907596 1:190518156-190518178 CTGAAAAAGAGGTGAGAACAAGG - Intergenic
919071160 1:192756630-192756652 CTGACAAAGAGAAGGGAAGATGG + Intergenic
919115663 1:193277389-193277411 TTGACAAAGAGAAGGGAAGATGG + Intergenic
919243923 1:194952399-194952421 CTGACAAAGAGAAAGGAAGATGG + Intergenic
919294573 1:195679674-195679696 CCTTACAAGAGGAAGGAAGAAGG + Intergenic
919380866 1:196859065-196859087 CTGGCAAAGAGAAGGGAAGATGG + Intronic
919605071 1:199671843-199671865 CTATACAAGAGAAAGGAAGAAGG + Intergenic
920144284 1:203844827-203844849 CAGAAAAAGGGGAGGGAGGAGGG - Intronic
921133655 1:212241198-212241220 CTGAAGAAGAGGAGGGGACATGG - Intergenic
921490786 1:215773238-215773260 CTGACAAGGAGAAGGGAAGATGG - Intronic
921819115 1:219596437-219596459 CTGGAAAAGAGGAGTGAGAAGGG + Intergenic
921879846 1:220243572-220243594 CTGAAAAAGTAGATGGAAGATGG - Intronic
922009764 1:221571193-221571215 GTGTTAAAGATGAGGAAAGAGGG - Intergenic
922212556 1:223497026-223497048 CTGGCAAAGAGAAGGGACGATGG - Intergenic
922283879 1:224151557-224151579 AAGTAAAGGAGAAGGGAAGATGG + Intronic
922543657 1:226437717-226437739 ATGGAAAAGAGGAGGGCTGAAGG - Intergenic
922614145 1:226951228-226951250 CTGAGAAAGTGGAGGGATGAAGG + Intronic
922716717 1:227879479-227879501 GTGACAAGGAGGAGGGAAGAAGG + Intergenic
923189507 1:231606956-231606978 CTATAAAGGAGGAGGGCAGTGGG + Intronic
923429815 1:233909237-233909259 CTGTAAACAAGGAAGTAAGAAGG + Intronic
923480647 1:234379986-234380008 CTGTAACAAAGAAGGGAAGCAGG + Intronic
923604068 1:235427539-235427561 CTGGAAAAGAGAAGGGAAGATGG - Intronic
923643955 1:235796143-235796165 CAAAAAAAGAGGAGGGAATATGG + Intronic
923699695 1:236288159-236288181 CTGACAAAGAAGAGGGAAGATGG - Intergenic
924046996 1:240042026-240042048 TCTTACAAGAGGAGGGAAGAGGG - Intronic
924298674 1:242614491-242614513 CACTAAAACAGGAGGGAAAAAGG - Intergenic
924309095 1:242721338-242721360 CTGAGAAAGCGGAGGGCAGATGG + Intergenic
924608228 1:245553174-245553196 GTGTAAAAGAGGAGTGGTGATGG - Intronic
924612956 1:245588991-245589013 CACTAAAAGAGGGGAGAAGAGGG - Intronic
924940652 1:248810838-248810860 CTGTAACAAAGGAAGTAAGAGGG + Exonic
1063055354 10:2498309-2498331 CTGTGAAAGATGTGGGGAGAGGG + Intergenic
1063689827 10:8276165-8276187 CTGGCAAAGAGAAGGGAAGGTGG + Intergenic
1063804336 10:9620957-9620979 TTGGCAAAGAGAAGGGAAGATGG - Intergenic
1063820115 10:9825066-9825088 CTGGCAAAGAGAAGGGAACATGG + Intergenic
1063926841 10:10986869-10986891 CTATATCAAAGGAGGGAAGAAGG + Intergenic
1064451817 10:15448856-15448878 CTGGCAAAGAGAAGGGAAGATGG + Intergenic
1064615228 10:17146596-17146618 GTTTAAAAGAGCAGGGATGATGG + Intronic
1064678001 10:17781055-17781077 CTGGCAAAGAGAAGGGAAGATGG + Intronic
1064928697 10:20599128-20599150 ATGTAAAAGAGGAAATAAGAGGG - Intergenic
1065442174 10:25764012-25764034 CTGGCAAAGAGAAGAGAAGATGG - Intergenic
1065780587 10:29162868-29162890 GTGTAGAGGAGGAGAGAAGAAGG + Intergenic
1066205951 10:33189398-33189420 ATGTAAAAGATGACGGAAGAGGG - Intronic
1066488513 10:35872156-35872178 CAGTAACAGGGAAGGGAAGAAGG + Intergenic
1067730005 10:48803727-48803749 ATGTAAAAGAGAAGGAAAGAAGG + Intronic
1068103976 10:52591254-52591276 CTGGCAAAGGGAAGGGAAGATGG - Intergenic
1068116897 10:52745980-52746002 CTGTCAAGGGGGTGGGAAGAGGG - Intergenic
1068479698 10:57575160-57575182 CTGACAAAGAGAAGGGAAGATGG + Intergenic
1068480363 10:57581105-57581127 CTGACAAAGAGAAGGGAAGATGG + Intergenic
1068601391 10:58960775-58960797 CTGGCAAAGAGAAGGGAAGATGG - Intergenic
1068677721 10:59785043-59785065 CTATAAAAGAGGAATGAAAATGG - Intergenic
1068711726 10:60142176-60142198 CTGTATAACAGGAGGGAAGGTGG - Intronic
1068963433 10:62887907-62887929 CTGTAAAAGATTAGTCAAGAAGG + Intronic
1069366435 10:67699086-67699108 CTTGAAAAGGTGAGGGAAGAAGG - Intergenic
1069441755 10:68434993-68435015 CTGTGAAAGAGGAGGGAATATGG + Intronic
1069671847 10:70212689-70212711 CTGGAGAGGAGGAGGGAATAGGG + Intronic
1069725799 10:70577319-70577341 AAGAAAAAGAGGAGGAAAGAAGG - Intergenic
1069759470 10:70798729-70798751 CTGGCAAAGAGAAGGGAAGATGG - Intergenic
1070182322 10:74026135-74026157 TTGAAAAAGAAAAGGGAAGATGG + Intronic
1070461186 10:76672043-76672065 CTGTCAAAGAGAAGGGAAGTTGG + Intergenic
1071171252 10:82867417-82867439 CTGTAAAAGAGGCTGGGAAATGG + Intronic
1071544047 10:86514487-86514509 TTGTGAAGGAGGAAGGAAGATGG + Intronic
1071714929 10:88085964-88085986 TTGGCAAAGAGAAGGGAAGATGG + Intergenic
1071808832 10:89155602-89155624 CTGAGAAACAGGAAGGAAGAGGG + Intergenic
1071864149 10:89707558-89707580 AGGTAAAAGGGAAGGGAAGAAGG - Intronic
1071867783 10:89755590-89755612 CTTTAAAAGAGGAAAGAAAAGGG - Intronic
1071907560 10:90190758-90190780 CAGTAAAGGAGTAGGGAAGCAGG + Intergenic
1071921452 10:90355495-90355517 CTGTAAAGGAGCAGACAAGATGG - Intergenic
1072153864 10:92706158-92706180 ATGGAAATGAGGAGAGAAGAGGG - Intergenic
1072404213 10:95134307-95134329 CTGGCAAAGAGAAGGGAAGATGG + Intergenic
1072754580 10:98010653-98010675 GTTTCAAAGAGGGGGGAAGATGG - Intronic
1073089404 10:100921948-100921970 CTGTAAAAGAGCAGAGATAAGGG + Intronic
1073921847 10:108467757-108467779 CTGAAAGATAGGCGGGAAGAAGG + Intergenic
1074517818 10:114187268-114187290 TGGCAAAACAGGAGGGAAGAGGG + Intronic
1074814673 10:117135008-117135030 CGGTGAAGGAAGAGGGAAGAAGG + Intronic
1074866548 10:117547276-117547298 CTGTTTAGAAGGAGGGAAGAGGG + Intronic
1075084067 10:119402390-119402412 CTGTAGAACTGGAGGGTAGAAGG - Intronic
1075107177 10:119547977-119547999 CTGGCAAAGACAAGGGAAGATGG + Intergenic
1075193932 10:120338219-120338241 TTTTAAAAGAGGAGAAAAGAAGG - Intergenic
1075283467 10:121161722-121161744 TTGAAAAAGAGAAGGGAAGTTGG - Intergenic
1075309930 10:121405554-121405576 CTGGAAAAGAGAAGGGGACATGG - Intergenic
1075851951 10:125596284-125596306 CCTTATAAGAGGAGAGAAGAAGG + Intronic
1076027774 10:127130443-127130465 CAGTTAAACTGGAGGGAAGAGGG + Intronic
1076348002 10:129793854-129793876 AAGGAAAAGAGGAAGGAAGAGGG - Intergenic
1076676140 10:132148697-132148719 CTGCACAGGAGGAGGGAGGAGGG + Intronic
1077743922 11:4879781-4879803 CTGTGTAAGAGGAGGGATGTAGG + Intronic
1078268397 11:9772365-9772387 CTAGCAAAGAGAAGGGAAGATGG - Intergenic
1078682384 11:13489036-13489058 TTTTAAAAGTGGGGGGAAGAGGG - Intergenic
1079017546 11:16881950-16881972 CTGAAAACGAGAAGGGCAGAGGG + Intronic
1079110531 11:17602720-17602742 AGGGAAGAGAGGAGGGAAGAAGG - Intronic
1079310219 11:19358740-19358762 CTGTGTAAGAGGTGGGAAGAGGG - Intronic
1079466848 11:20739172-20739194 CTGACAAAGAGCAGGGAACACGG + Intronic
1080123471 11:28704044-28704066 CTGGAAAAAAGGAGGAAGGAAGG - Intergenic
1080311559 11:30898972-30898994 GTGTTAAAGAGAATGGAAGAAGG + Intronic
1080684629 11:34504851-34504873 CTGAGAAAGAGGAGGGAGGGTGG + Intronic
1081165931 11:39809307-39809329 TAGTAAAAGAAGAGAGAAGAAGG + Intergenic
1081187165 11:40058056-40058078 CTGTAAGAGAGGCTAGAAGATGG - Intergenic
1081331474 11:41805663-41805685 CTGTAAAAGAGTAGTGATAAGGG + Intergenic
1081459068 11:43254258-43254280 TAGAGAAAGAGGAGGGAAGAGGG - Intergenic
1081540001 11:44027565-44027587 CTGAAAAAGGGGAAAGAAGAAGG - Intergenic
1081716798 11:45256232-45256254 GTGGAGAAGAGGAGGGAGGAAGG - Intronic
1081777995 11:45689609-45689631 ATGTCAAAGAGAAGGGAAGCTGG - Intergenic
1081824826 11:46039058-46039080 CTGAATAAAAGTAGGGAAGAAGG + Intronic
1082758812 11:57106197-57106219 CTGTAAAAAGGGAGGAAAGGGGG + Intergenic
1082934246 11:58639896-58639918 CTGTAACAGATGAAGGAAGTGGG - Intergenic
1083580890 11:63824649-63824671 CTGGAAAAGAGGATGGAACCAGG - Intronic
1084096674 11:66915862-66915884 CTGTAAAGGACGAAGAAAGAAGG - Intronic
1084337975 11:68472292-68472314 ATGTAACAGAGAAGTGAAGAAGG - Intronic
1087273597 11:96138421-96138443 CTGTAAAAGAGGGAGCAAAATGG + Intronic
1087408277 11:97756767-97756789 CTATAAAGTAGGAGGAAAGAGGG - Intergenic
1087700471 11:101431344-101431366 CTGTGAAAGAGGGGAAAAGAAGG - Intergenic
1087796335 11:102458247-102458269 CTGTAAAGGAGGAGACAAGAAGG - Intronic
1087933449 11:104004184-104004206 CTGTAGAAGGGGTGGGGAGAGGG + Intronic
1088041543 11:105390256-105390278 GTGAAAAAGAAAAGGGAAGATGG + Intergenic
1088422588 11:109665884-109665906 CTGGCAAAGAGAAAGGAAGATGG - Intergenic
1088615656 11:111625062-111625084 CAGTAGAAGAGGAGGTCAGAGGG + Intronic
1088620081 11:111672592-111672614 CACTAGAAGAGGAAGGAAGATGG + Intronic
1088799843 11:113295676-113295698 CTGTTAAAGAGAAGGGAAGATGG - Intergenic
1089061242 11:115627803-115627825 CTCTGAAAGAGGAGGTAAGCTGG + Intergenic
1089581309 11:119483427-119483449 AGGTAAAAGAGGGGGGAAGGTGG - Intergenic
1089720654 11:120417169-120417191 CTGTAAAACATGAGGGAAACGGG - Intronic
1090062075 11:123472825-123472847 CTGGCAAAGAGAAGGGAAGATGG + Intergenic
1090248104 11:125231331-125231353 TTGGAAAAGAGGCGGGGAGAGGG - Intronic
1090292264 11:125555629-125555651 CTGTAAAGGAGCAGACAAGATGG - Intergenic
1090441574 11:126729096-126729118 CTGCTAGAGATGAGGGAAGATGG - Intronic
1090624938 11:128598514-128598536 GTGTAAAATAGGAGGGGAGTGGG + Intergenic
1090800370 11:130167608-130167630 CTGTGATAGGGGAGGGAAGGGGG - Intronic
1091099554 11:132858298-132858320 CGGTCAAAGAGGAGGGAACCTGG - Intronic
1091337223 11:134781514-134781536 GTGGAAAAGAGGAAAGAAGAGGG - Intergenic
1091765409 12:3117139-3117161 CTGGAAAACAGGAGGGGAAATGG - Intronic
1092307259 12:7314140-7314162 ATGTAGAAGATGAAGGAAGAAGG + Intronic
1092600922 12:10063451-10063473 ATTAAAAAGAGGAGGGAATAAGG + Intronic
1093923736 12:24888897-24888919 CTGACAAAGAGAAGGGAAGATGG - Intronic
1094183455 12:27616114-27616136 AGGGAAAAGAGGAGGGAGGAAGG - Intronic
1094357531 12:29594206-29594228 CTGTAGAAGAGTAGAGAAGGTGG - Intronic
1094488267 12:30941910-30941932 ATTTAAAAGAAGTGGGAAGAAGG - Intronic
1094572329 12:31651973-31651995 CTGACAAAGGGAAGGGAAGATGG - Intronic
1094775595 12:33723797-33723819 CAGTTAAAGTGAAGGGAAGAGGG - Intergenic
1095335006 12:41013254-41013276 CTGAGAAAGAAAAGGGAAGATGG + Intronic
1096298797 12:50407495-50407517 TTTTAAAAGAGGAATGAAGATGG + Intronic
1096353558 12:50919884-50919906 CTGACAAAGAGAAGGGAAGATGG - Intergenic
1096609547 12:52791817-52791839 CTGCAGAACAGAAGGGAAGATGG + Intronic
1096636143 12:52960791-52960813 CTGAAAAAGATGAGGAGAGAGGG - Intergenic
1097583664 12:61489426-61489448 CTCTGAAACAGGAGGGAAGGAGG - Intergenic
1097825645 12:64172448-64172470 AAGGAAAAGAGGAGGGAGGAGGG + Intergenic
1098507471 12:71270768-71270790 CTGTTGAAGAGCAGGGAGGAGGG - Intronic
1098513445 12:71346111-71346133 CTATAAAGGACGAGGGAAGTGGG - Intronic
1099442134 12:82712003-82712025 CAGGAAAGGAGGAGGGAAAAGGG - Intronic
1100591707 12:96035793-96035815 CTGAAGAAGAGGAGGGGAGTAGG + Intronic
1100628448 12:96361342-96361364 AAGTAAAAGAGGAGGGACAAAGG - Intronic
1100834184 12:98550536-98550558 CAGTAAAAGTGGTGGGAAAAAGG - Intergenic
1100865519 12:98853054-98853076 CTGTAAAAGATGACAGAAGCTGG + Intronic
1101062296 12:100984755-100984777 GTGAAAAAGAGGAAGCAAGAAGG - Intronic
1101664236 12:106795636-106795658 CTGACAAAGAGAAGGGAAGATGG + Intronic
1101860375 12:108477728-108477750 CTGACAAAGAGAAGGGGAGATGG - Intergenic
1102225624 12:111226247-111226269 TTATCAAAGAGGAGGGAGGATGG - Intronic
1102244131 12:111344337-111344359 CTGTGAAACAGGAAGGAACAAGG + Intronic
1102599207 12:114016239-114016261 CAGGAGAACAGGAGGGAAGAGGG + Intergenic
1104066376 12:125310430-125310452 CTGTAAAATGGGAGGGACCATGG - Intronic
1104602979 12:130165485-130165507 GTGGAAAGGAGGGGGGAAGAGGG + Exonic
1105048093 12:133023655-133023677 CTGTAGAAGAGGAGATGAGATGG - Exonic
1105515774 13:21089635-21089657 TTGTAGAAGTGGAGGGTAGAGGG + Intergenic
1105812701 13:24008881-24008903 CAGCCAAGGAGGAGGGAAGAGGG + Intronic
1106713550 13:32364514-32364536 CTGTATTAGTAGAGGGAAGATGG - Intronic
1106725042 13:32475628-32475650 CTGACAAACAGAAGGGAAGATGG + Intronic
1107013259 13:35688563-35688585 CTGTAAAGGAGCAGACAAGATGG - Intergenic
1107020039 13:35741862-35741884 ATGACAAAGAGAAGGGAAGATGG + Intergenic
1107117478 13:36762532-36762554 CTGACAAAGAAAAGGGAAGATGG + Intergenic
1107229519 13:38091273-38091295 CTGACAAAGAGAAGGGAAGATGG + Intergenic
1107838959 13:44436096-44436118 CTGAAAAAGAGGAGGGAAAAAGG + Intronic
1108055106 13:46477737-46477759 CTGACAAAGAGAAGGGAAGATGG + Intergenic
1108716490 13:53084060-53084082 CTGTAAAAAAAGGGGGGAGAGGG - Intergenic
1109106583 13:58259627-58259649 CTTTAAAAAAGCAGTGAAGATGG - Intergenic
1109612656 13:64786938-64786960 CTGACAAAGAGCAGGGAAGATGG + Intergenic
1109660920 13:65459004-65459026 CTGGCAAAGAGAAGGGAAGATGG + Intergenic
1109703825 13:66062406-66062428 CTGACAAAGAGAAGGGAAGATGG + Intergenic
1109704358 13:66070590-66070612 TTGTAAAAATGGAGGGAAAATGG + Intergenic
1110011454 13:70339738-70339760 CTGGCAAAGGGAAGGGAAGATGG - Intergenic
1110592963 13:77285993-77286015 CTCTAAAACAGGAGGCAAAAAGG + Intronic
1110710924 13:78649930-78649952 CTGAAAACGAGAAGGGAAGTGGG + Intronic
1110975857 13:81833122-81833144 CTGACAAAGAGAAGGGAAGATGG + Intergenic
1111386973 13:87539953-87539975 CTGGAAAAGAGGAGGTGGGAAGG + Intergenic
1111577531 13:90175930-90175952 CTGGCAAAGAAAAGGGAAGATGG - Intergenic
1112286055 13:98105415-98105437 CTGGCAAAGAGAAGGGAAGATGG - Intergenic
1112583368 13:100695346-100695368 CTGTAAAAAAAGAAGGAATATGG - Intergenic
1113222776 13:108124244-108124266 CTGACAAAGAGGAGGGAAGATGG - Intergenic
1113336168 13:109378222-109378244 CTTTAAAAGTGGAGGCAAGCCGG + Intergenic
1113610681 13:111642777-111642799 CTGTAAAAGTGGAGGCAGAAAGG - Intronic
1113827240 13:113265839-113265861 CTGTAAAAGTGGAAAGGAGAAGG + Intronic
1114627345 14:24138131-24138153 CTAGAAAAGAGCAGGGAAGTGGG - Intronic
1114690398 14:24575100-24575122 GTGTAAATGAGGAGGAAAGGAGG - Intronic
1115173999 14:30541363-30541385 CTGTAGAAGAGGAGGGCCTAGGG + Intergenic
1115661072 14:35494686-35494708 GGGGAAAAGGGGAGGGAAGAGGG + Intergenic
1115834548 14:37385162-37385184 CTGTAAAATATGGTGGAAGAGGG + Intronic
1116104158 14:40477380-40477402 CTGACAAAGAGAAGAGAAGATGG + Intergenic
1116501023 14:45622135-45622157 CTTAAAAAGAGAAGGGAACATGG - Intergenic
1116538312 14:46064164-46064186 CTCGCAAAGAGAAGGGAAGATGG + Intergenic
1116691030 14:48105823-48105845 CTGGCAAAGAGAAGGGAACAAGG + Intergenic
1117181104 14:53192591-53192613 CTGTCAGGGAGGAAGGAAGAAGG + Intergenic
1117275837 14:54192538-54192560 CTGTAAAGAAGAAGGGAAGCAGG + Intergenic
1117459590 14:55931869-55931891 CTGGCAAAGAGAAGGGAAGATGG - Intergenic
1117868560 14:60174491-60174513 TTGTCAAAAAGAAGGGAAGATGG - Intergenic
1118208912 14:63748926-63748948 CTGGCAAAGAGAAGGGAACATGG - Intergenic
1118337912 14:64870107-64870129 CTGTAAGAAAGGAGTGAAAAGGG + Intronic
1119343069 14:73897303-73897325 CTTTAAAGGAACAGGGAAGAAGG + Intronic
1120408931 14:84126112-84126134 CTGCATAAGAGTAGGAAAGAGGG + Intergenic
1120424296 14:84328073-84328095 CTGACAAAGAGAAGGGAAGATGG - Intergenic
1120827761 14:88970601-88970623 CTTTAAAACAGGAGGGAGGCCGG + Intergenic
1120860926 14:89254394-89254416 CTGTAAGGGAGGTGGGGAGAAGG + Intronic
1121445614 14:93977017-93977039 GAGTGAAAGAGAAGGGAAGAAGG + Intergenic
1122926363 14:104904709-104904731 CTTCAAAGGAGGAGGGAGGAGGG - Intergenic
1123148947 14:106163145-106163167 GTGTGAGAGAGGAGGGAGGAAGG + Intergenic
1123771482 15:23534202-23534224 CTGACAAAGAGAAAGGAAGATGG - Intergenic
1124330023 15:28803486-28803508 CTGAAGAAGAGGAGGAAGGAGGG + Intergenic
1124376717 15:29133243-29133265 TTGGTAAAGAGGAGAGAAGATGG - Intronic
1125431516 15:39599488-39599510 AGGAAAAAGGGGAGGGAAGAGGG - Intergenic
1125617803 15:41031404-41031426 AAGTGAAAGAGAAGGGAAGAGGG + Intronic
1125971892 15:43918455-43918477 CAGAAAAGGAGGAGGGAAGAAGG - Intronic
1126052096 15:44695386-44695408 CTGACAAAGAAAAGGGAAGATGG - Intronic
1126310444 15:47310010-47310032 CTGTACAAGAAAAGGGAACATGG + Intronic
1126634085 15:50765277-50765299 GTGGAAAAGAGGAGGGTGGAAGG + Intronic
1127653948 15:61037793-61037815 CTATAATAGAAGATGGAAGAAGG + Intronic
1128149930 15:65356293-65356315 TGGGAAAAGAAGAGGGAAGATGG + Intronic
1128160891 15:65422363-65422385 GTGTAAAAGAGGAGGGAACTGGG - Intronic
1128175124 15:65548571-65548593 CTCAAAAAAAGGAGTGAAGAGGG - Intronic
1128565021 15:68695354-68695376 ATGACAAAGAGGAGGGAAGAAGG - Intronic
1128774798 15:70311995-70312017 CTGTGATTGAGGAGGGAACAGGG - Intergenic
1129265311 15:74390131-74390153 CTGTAAAGGAGTGGGGGAGATGG + Intergenic
1129368963 15:75076022-75076044 CAGAAAAAATGGAGGGAAGAAGG + Intronic
1129793685 15:78360344-78360366 CAGAGAAAGAGAAGGGAAGAGGG + Intergenic
1130036504 15:80366209-80366231 CTGACAAAGAGAAGGGAAGATGG - Intronic
1130550079 15:84884766-84884788 CAGTAGGAGAGGAGGGAAGGCGG + Intronic
1130978268 15:88793839-88793861 GTGTAAAACAGGAGGCAAGAAGG + Intergenic
1131962789 15:97807166-97807188 TTCCAAAAGAGGACGGAAGAGGG - Intergenic
1132088406 15:98926949-98926971 AGGAAAAAGAGGAGGGAAGGAGG - Intronic
1132737128 16:1392427-1392449 CAAAAAAAGAGGGGGGAAGAGGG - Intronic
1133260061 16:4543332-4543354 ATATGAAAGAGGAGGGCAGAGGG + Intergenic
1133317560 16:4893821-4893843 CTACGAAAGAGGAGGGAAGGAGG - Intronic
1133679742 16:8109701-8109723 CTGACAAAGAGAAGGGAAGATGG + Intergenic
1133703266 16:8329241-8329263 CTTTATAGGAGGAGGGGAGATGG + Intergenic
1133778057 16:8913353-8913375 CTCAAAAAGAGGAGAGAAGAGGG + Intronic
1134001629 16:10787437-10787459 CTGGAAAGGAGAAGGGAAGATGG - Intronic
1134485927 16:14658386-14658408 CTGACAAAGAGAAGGGAAGATGG + Intronic
1134567291 16:15262509-15262531 CTGGCAAAGAGAAGGGAAGATGG + Intergenic
1134735200 16:16494191-16494213 CTGGCAAAGAGAAGGGAAGATGG - Intergenic
1134932321 16:18218026-18218048 CTGGCAAAGAGAAGGGAAGATGG + Intergenic
1136423336 16:30151445-30151467 CTGACAAAGAGAAGGGAAGATGG + Intergenic
1136504685 16:30695413-30695435 GTGGGAGAGAGGAGGGAAGATGG - Intergenic
1136681277 16:31964437-31964459 GTGTGAGAGAGGAGGGAGGAAGG - Intergenic
1136781589 16:32905949-32905971 GTGTGAGAGAGGAGGGAGGAAGG - Intergenic
1136888204 16:33947891-33947913 GTGTGAGAGAGGAGGGAGGAAGG + Intergenic
1137378903 16:47979490-47979512 TTGTAAAAGAGGCAGGAGGAGGG - Intergenic
1138092410 16:54186578-54186600 CTGGAAAAGAGGTGGGGAGGAGG + Intergenic
1139827027 16:69765491-69765513 TTGTAATAAAGCAGGGAAGAGGG + Intronic
1139917560 16:70438037-70438059 CTGTAAAGCAAGAGGGAAGATGG + Intronic
1140331880 16:74065862-74065884 TTGAAATAGAGGAGGGAAGTGGG + Intergenic
1140426739 16:74867496-74867518 TTGGCAAAGAGAAGGGAAGATGG - Intergenic
1141191065 16:81824925-81824947 CTTTAAAAGAGGAAGGTAGGAGG + Intronic
1141211711 16:81987130-81987152 CTGGAAATGAGGGAGGAAGATGG - Intergenic
1141263753 16:82476900-82476922 ATGAGAAAGAGAAGGGAAGATGG - Intergenic
1141400285 16:83741348-83741370 CTGTAAAACTGTAGGAAAGAAGG - Intronic
1141412710 16:83846284-83846306 CTGGCAAAGGGAAGGGAAGACGG + Intergenic
1141613703 16:85198271-85198293 CTGTAAAAGGGGAGAGGAAAGGG + Intergenic
1141756777 16:85996730-85996752 CAGTAAGAGAGGAAGGAAGGAGG + Intergenic
1142251409 16:88993663-88993685 GGGGAAAGGAGGAGGGAAGAGGG - Intergenic
1142399895 16:89853026-89853048 CTGAGAGAGAGGACGGAAGATGG - Intronic
1203084244 16_KI270728v1_random:1169931-1169953 GTGTGAGAGAGGAGGGAGGAAGG - Intergenic
1142614716 17:1127587-1127609 CTGGAGAGGAGGAGGGAGGAGGG - Intronic
1142782073 17:2189211-2189233 CTGAAAAAGTGACGGGAAGAGGG - Intronic
1143322595 17:6077818-6077840 CTGTATAACTGAAGGGAAGAGGG - Intronic
1145118597 17:20235070-20235092 TGTTAAAAGAGGTGGGAAGAGGG + Intronic
1145970613 17:28954340-28954362 CTGGCAAAGAGGAGGAAATAAGG + Intronic
1146512506 17:33462283-33462305 ATGTAAAAGAGGCTGGAAAATGG - Intronic
1146596568 17:34174286-34174308 CTGGCAAAGAGAAGGGAACATGG + Intronic
1146657582 17:34644098-34644120 CTGTCCAAGAGGATGGATGAAGG - Intergenic
1146672601 17:34751988-34752010 CTCTCAAAGTGGAGGGGAGAAGG + Intergenic
1147535829 17:41322901-41322923 CAGACATAGAGGAGGGAAGATGG - Intergenic
1147773679 17:42885421-42885443 CTATAGGAGAGGAGGGAAGGAGG - Intergenic
1148140009 17:45321615-45321637 CTGTAGAAGAGGAGGGGCCATGG + Intergenic
1148467550 17:47873948-47873970 GAGGAAAGGAGGAGGGAAGAGGG - Intergenic
1148571982 17:48677685-48677707 CTGTGAAAAAGGAGGGAGGGAGG - Intergenic
1148851447 17:50557459-50557481 CTGTAAATGGGTTGGGAAGAAGG + Intergenic
1149187568 17:54017437-54017459 CTGGCAAAGGGAAGGGAAGATGG - Intergenic
1149289257 17:55200013-55200035 CTTTACAACAGGAGGGAAGGTGG - Intergenic
1150965552 17:69963937-69963959 TTGTTAAAGAGTAAGGAAGATGG - Intergenic
1150997050 17:70330768-70330790 CAGTAAAAGAGAAGGCAAAAAGG + Intergenic
1151116990 17:71747553-71747575 ATGAAAAAGAGAAAGGAAGAAGG + Intergenic
1151618273 17:75228975-75228997 CTGTAAGCCAGGAGGGAAGAAGG - Intronic
1152028213 17:77825341-77825363 AGGCAAAAGAGGTGGGAAGAAGG + Intergenic
1152181880 17:78827346-78827368 CTCTAAAAGAGGAAGAAACAGGG + Exonic
1152608551 17:81304811-81304833 CAGGAAAAGGGGAGGGCAGAGGG - Intergenic
1153516343 18:5905781-5905803 TTGTAGGACAGGAGGGAAGATGG - Intergenic
1153673879 18:7438511-7438533 CTCCAGAAGAGCAGGGAAGACGG - Intergenic
1153705946 18:7746039-7746061 CAGAAAAAGAGGAGAGAATAGGG + Intronic
1153827909 18:8893670-8893692 CTGGAGGAGAGGAGGGAAGGGGG + Intergenic
1154061437 18:11064387-11064409 TGGTAAAAGAGGAGGGAAGAAGG - Intronic
1154078955 18:11235065-11235087 CTGTGAAAGATGAGGTCAGACGG - Intergenic
1154369418 18:13745482-13745504 GGGTAAAAGAGAAGGGGAGATGG + Intronic
1155466577 18:26142456-26142478 CTAAAAAAGAGGAGAGAAAAAGG + Intronic
1156949791 18:42881104-42881126 GTTTAAAAGAGGTAGGAAGATGG - Intronic
1156981556 18:43295013-43295035 AAGGAAAGGAGGAGGGAAGAAGG + Intergenic
1157015637 18:43709382-43709404 CAGTAGAAGAGGGGGGAAAATGG + Intergenic
1157273526 18:46294363-46294385 CTGCCAAAAAAGAGGGAAGAGGG - Intergenic
1157332724 18:46715178-46715200 CTGCAGAAAAGGAGGGAAAAAGG - Intronic
1157445749 18:47745643-47745665 CTGTAACCCACGAGGGAAGATGG - Intergenic
1157739708 18:50081460-50081482 CTGTAAAGGTGGTGGGAAAAGGG + Intronic
1157871692 18:51235366-51235388 CTGTGAAAATGGAGGGAAGATGG - Intergenic
1158016023 18:52785212-52785234 CTGACAAAGAGAAGGGAAGATGG + Intronic
1158016873 18:52793256-52793278 CTGACAAAGAGAAGGGAAGATGG + Intronic
1158060921 18:53340416-53340438 CTGCAAAAGAAGATGAAAGAAGG + Intronic
1158287105 18:55895898-55895920 TTGTAATATAGGATGGAAGAAGG + Intergenic
1158492012 18:57918601-57918623 CCTTACAAGAGGAGGGCAGAGGG - Intergenic
1159139956 18:64381680-64381702 GTGACAAAGAGAAGGGAAGATGG - Intergenic
1159174169 18:64812964-64812986 CTGTAAAGGAGCAGACAAGATGG + Intergenic
1159725124 18:71947964-71947986 AAGGAAAAGAGGAAGGAAGAGGG + Intergenic
1159946497 18:74447914-74447936 CTGGAGAAGAGGAGGGACCAAGG + Intronic
1159991419 18:74913368-74913390 CTGTTAAAAAGGAGAAAAGAAGG + Intronic
1160107704 18:75993991-75994013 CAGAAAGAGAGGAGGGAAAAGGG - Intergenic
1161374644 19:3933297-3933319 CTGGCCAGGAGGAGGGAAGAGGG + Intronic
1161615279 19:5266766-5266788 GAGAAAAAGAGGAGGGAAGGTGG - Intronic
1161826953 19:6574165-6574187 CTGGCAAAGAGAAGAGAAGACGG + Intergenic
1161830742 19:6602409-6602431 CTGTAAAGGAGCAGACAAGATGG + Intronic
1162155920 19:8677891-8677913 ATGGAAAGGAGGAAGGAAGAGGG - Intergenic
1163047704 19:14656635-14656657 CTGGCAAAGAGAAGGGAAGATGG + Intronic
1163066538 19:14800713-14800735 CTGACAAAGAGAAGGGAAGATGG - Intronic
1163933823 19:20423906-20423928 CAGGGAAAGAAGAGGGAAGAAGG + Intergenic
1164772938 19:30826102-30826124 CTGTAAGTGAGAAGGGTAGAGGG + Intergenic
1164991414 19:32687237-32687259 CCGACAAAGAGAAGGGAAGATGG - Intergenic
1165428045 19:35756394-35756416 CTCCAGAAGAGGAGGGGAGAGGG - Intronic
1165840803 19:38788274-38788296 CTGCAAAATTGGTGGGAAGATGG + Intergenic
1166114165 19:40642543-40642565 CTGTAAATAAAGAAGGAAGAGGG + Intergenic
1166221808 19:41370004-41370026 CTGCAGAAGAGGGGGGAATAGGG - Intronic
1166602728 19:44112240-44112262 CTGACAAAGAGAAGGGAAGATGG + Intronic
1167696904 19:51020094-51020116 CTGTGGAAGAGGAAGGAGGAAGG + Intronic
1168331239 19:55570421-55570443 CTGTAAAAAAGGAATGAAGAGGG + Intergenic
1202698029 1_KI270712v1_random:139642-139664 ATGGAAAAGGAGAGGGAAGAAGG - Intergenic
925323225 2:2993253-2993275 CCGACAAAGAGAAGGGAAGATGG - Intergenic
925420859 2:3710354-3710376 CTGTCAGAGAGGAGGAATGAGGG - Intronic
925472455 2:4176674-4176696 CTGACAAAGAGAAGGGAAGATGG + Intergenic
925746314 2:7046651-7046673 AAGGAAAACAGGAGGGAAGAGGG - Intronic
926262326 2:11277043-11277065 CTGAAAAAGAGAAGGGGACAGGG - Intronic
927001828 2:18803560-18803582 CTGTAAAATAAGATAGAAGAAGG - Intergenic
928538250 2:32260696-32260718 TTGAAAAAGAAAAGGGAAGATGG - Intronic
928771512 2:34707435-34707457 CTGTAGAAGAGAAGGGCAGAAGG + Intergenic
929195650 2:39181679-39181701 CCTTATAAGAAGAGGGAAGATGG + Intronic
929245059 2:39692625-39692647 CTATAAAGGGGGAGGGGAGAGGG + Intronic
929391888 2:41478590-41478612 CTGTAGGATAGAAGGGAAGATGG - Intergenic
929446501 2:42005701-42005723 CTGGAAGAGATGATGGAAGAAGG + Intergenic
929493907 2:42422898-42422920 CTGGATAAGAGGAGGAAAGGGGG - Intronic
930112656 2:47692139-47692161 CTGAAAAAAATGAGGGGAGAGGG - Intergenic
930463026 2:51708078-51708100 AAGTATAAGAAGAGGGAAGAAGG - Intergenic
930494639 2:52125935-52125957 CTGGCAAAGAGAAGGGAAGATGG + Intergenic
930621744 2:53651410-53651432 CTGGCAAAGAGAAGGGAACATGG - Intronic
930622027 2:53653363-53653385 CTGGCAAAGAGAAGGGAAGATGG + Intronic
930673573 2:54176942-54176964 CTGTGAAAGGAGAGGGAAGCTGG - Intronic
931466095 2:62488086-62488108 CTATCAAAGAGGAGGGATGTGGG + Intergenic
931687649 2:64808229-64808251 CTGACAAAGAGAAGGGAAGATGG - Intergenic
932724199 2:74163979-74164001 CTGAAAAAGAAGAGCGAGGAAGG + Intronic
933276797 2:80292470-80292492 CTCTGAACGAGGAGGGATGAAGG + Intronic
933659790 2:84917948-84917970 CTGGCAAAGAGAAGGGAAGGTGG + Intergenic
933803782 2:85983344-85983366 CTGTAAAGAAGGAGTGAAGCTGG - Intergenic
933943938 2:87268106-87268128 CTGAGAAAGACGGGGGAAGAAGG + Intergenic
934039372 2:88115358-88115380 CAGTAAAAGAGGAAGGCAGGAGG - Intergenic
934279283 2:91597422-91597444 ATGGAAAAGGAGAGGGAAGAAGG - Intergenic
934665306 2:96165191-96165213 CTGGAAAATAGGATGGAAGTTGG - Intergenic
934695907 2:96400012-96400034 CTGTTGCTGAGGAGGGAAGAGGG - Intergenic
935009787 2:99123086-99123108 CTGAAAAACTGGAGGTAAGAAGG - Intronic
935850823 2:107216985-107217007 CTGGCAAAGAGAAAGGAAGATGG - Intergenic
935880469 2:107559775-107559797 CTGTAAAGGAGCAGACAAGATGG + Intergenic
936336282 2:111593473-111593495 CTGAGAAAGATGGGGGAAGAAGG - Intergenic
937010813 2:118561076-118561098 CTGACAAAGAGAAGGGAAGATGG - Intergenic
937469189 2:122160890-122160912 GTGTAAAGGCGGAGGCAAGATGG + Intergenic
937539507 2:122931259-122931281 CAGTGAAAAAGGAGGGCAGAAGG + Intergenic
937703205 2:124887647-124887669 CTGAAAATGAGGATGAAAGAAGG + Intronic
937798722 2:126056655-126056677 CTGATAAATAGAAGGGAAGATGG - Intergenic
938694942 2:133826533-133826555 TTGTTAAAGAGAAGGGAAGCAGG + Intergenic
939131692 2:138242979-138243001 TTGGCAAAGAGAAGGGAAGATGG + Intergenic
940188732 2:151015617-151015639 CTGGAAAAGAGTAGAGAAAATGG - Intronic
940401950 2:153257461-153257483 CTGTTAGAGAGGAGCCAAGATGG - Intergenic
940481827 2:154242007-154242029 CTGAAAAAGAGAAAAGAAGAGGG - Intronic
940485405 2:154290238-154290260 CTGAAACAAAGCAGGGAAGAAGG + Intronic
941347743 2:164391010-164391032 CTGTTAAAGACTAGTGAAGATGG + Intergenic
942656326 2:178217781-178217803 CTGACAAAGAGAAGGGAAGATGG + Intronic
942713470 2:178864582-178864604 CTGTTAAACAGGAGGGAAGCAGG - Intronic
943169820 2:184384592-184384614 CTTTAAAAGTGGAGGAAGGAGGG - Intergenic
943445875 2:187987348-187987370 CTGTTAAGGAGGAGAAAAGAGGG + Intergenic
943718509 2:191178527-191178549 CTAAAGAAGAGGAGGAAAGAAGG - Intergenic
943986117 2:194621392-194621414 CAGAAAAAGAGGAGAGAAAAAGG - Intergenic
944587228 2:201183057-201183079 CTGGAAAAGGGGAGGGAAAAAGG + Exonic
945214826 2:207422148-207422170 TTGTAAAAGAGAAGGGAAGTGGG + Intergenic
945588115 2:211692676-211692698 CTTTATAAGAGGAAGGTAGAGGG - Intronic
946035868 2:216741764-216741786 CTCTAATAGAGGAGGGAAACAGG - Intergenic
946115790 2:217460904-217460926 TTGTAAAAGTGGAGGGAAAGAGG + Intronic
946162376 2:217843371-217843393 ATGTAGAAGAGGAGGGGAGTAGG - Intronic
946980346 2:225206486-225206508 CTTTAACATAGGAGTGAAGAAGG + Intergenic
947282748 2:228473650-228473672 TTGGTAAAGAGAAGGGAAGATGG + Intergenic
947300732 2:228685773-228685795 GACTAAAAGAGGTGGGAAGAAGG + Intergenic
948400217 2:237678943-237678965 CTGTAAAATGGGAGGGATAATGG - Intronic
948581662 2:238991317-238991339 CAGGAAAAGAGCAAGGAAGAGGG - Intergenic
948838410 2:240637204-240637226 CTGTAACACAGGAGGGAAACCGG - Intergenic
948865830 2:240774324-240774346 CTGTAAATGTGGGGGGAAGGGGG - Intronic
1169112045 20:3040516-3040538 AAGTAAAAGAGGAGTGAAGAGGG - Intergenic
1169198123 20:3694151-3694173 CTTTAAAAGAGGAGAGGAGGTGG - Intronic
1169654704 20:7910505-7910527 CTGGAAAAGACAAGGGAATAGGG - Intronic
1169744712 20:8931934-8931956 CTGGAAAAGAGAAGGGTGGATGG - Intronic
1169790820 20:9408610-9408632 CTGTAAAAGAAAAGCAAAGATGG - Intronic
1169924942 20:10773342-10773364 ATGCAAAAGATGAGGAAAGAGGG - Intergenic
1170092104 20:12601189-12601211 CTACAAAAGAGGAGGAAATAAGG - Intergenic
1170709654 20:18778872-18778894 CTGTCACAGTGGAGGGAAGTAGG + Intergenic
1170883409 20:20317487-20317509 CTTTAAAAGAGAAGTGAAAATGG - Intronic
1171030004 20:21668847-21668869 TTGTAGAAGGGGAGGGAAGGAGG + Intergenic
1171128598 20:22627186-22627208 TTTTAAAAAAGGAGGCAAGAAGG + Intergenic
1171134566 20:22684905-22684927 CTGTAAGAGAGTGAGGAAGAGGG + Intergenic
1171462372 20:25305659-25305681 CTTTAAAAAAAGAGGGAAGTAGG - Intronic
1172028648 20:31966911-31966933 CTGTAAAATGGGAGGAAAAAAGG + Intergenic
1172199958 20:33118436-33118458 CTGGAGAAGAGGAGTGAAGCAGG + Intergenic
1172629015 20:36365965-36365987 CTGTAAAATTGGAGGGGAGAGGG + Intronic
1172764591 20:37344865-37344887 CTGTAAAACCGGAGTGAACATGG - Intronic
1173022138 20:39275587-39275609 CAATAAAAGAGAAGAGAAGATGG - Intergenic
1173445501 20:43114210-43114232 CTCTAACACAGGAGGGAACATGG + Intronic
1173887422 20:46472637-46472659 CTGAAAAAGAAGAGGGATAAAGG + Intergenic
1173912876 20:46683382-46683404 TGGTAAAAGAAAAGGGAAGATGG - Intronic
1174062633 20:47843476-47843498 CTTTATAAGAGGAGGGCAGGAGG + Intergenic
1174103101 20:48142201-48142223 CTGTGTATGAGGAGGGAGGAGGG - Intergenic
1174502593 20:50996638-50996660 CTGTAAAGGAGGAGGGAGGCAGG + Intergenic
1174514062 20:51077689-51077711 CAGAGAAAGAGGAGGCAAGATGG - Intergenic
1174516853 20:51099138-51099160 CTGCAGAAGGGGAGGGAGGAGGG + Intergenic
1174869221 20:54168010-54168032 CTGTAACAGAGGCTGGCAGAGGG - Intronic
1174869659 20:54171373-54171395 CTTTAAAAGAGGGTGGAGGAGGG + Intronic
1175657819 20:60787077-60787099 GGGTAGAGGAGGAGGGAAGAGGG - Intergenic
1176032725 20:63021504-63021526 CTGTAGGACAGGAGGGAAGGAGG - Intergenic
1176675420 21:9772668-9772690 TTGACAAAGAGAAGGGAAGATGG + Intergenic
1176972982 21:15288233-15288255 CTCTAAAACAGGAGAGAAGATGG - Intergenic
1176996182 21:15558056-15558078 CTGGCAAAGTGAAGGGAAGATGG - Intergenic
1177236456 21:18396039-18396061 CGGTAAAGGAGTATGGAAGATGG + Intronic
1177943411 21:27438899-27438921 CTGAGAAAGAGGAGAGGAGAAGG - Intergenic
1178417462 21:32415367-32415389 CTGTGAAGGAGGAGGGAGGATGG + Intronic
1178819755 21:35964220-35964242 CTATCAAAGAAAAGGGAAGATGG + Intronic
1179054587 21:37919364-37919386 CTGTAAACGAGCAGACAAGATGG + Intergenic
1179237282 21:39559142-39559164 CTGACAAAGACAAGGGAAGATGG + Intronic
1179242317 21:39603182-39603204 CTGTAAAAGAGGAGGAAATTTGG + Intronic
1179483242 21:41691893-41691915 CTGAAGAAGAGGATGGATGAGGG + Intergenic
1179487798 21:41722112-41722134 AGGAAAAGGAGGAGGGAAGAAGG - Intergenic
1179986384 21:44923233-44923255 CAGTACAAGAGGAGAGACGAAGG + Intronic
1181778391 22:25176177-25176199 CAGTGAAAGAGGGGGAAAGACGG - Intronic
1181910229 22:26232850-26232872 CTGTAAAACAGGGAGGAACACGG + Intronic
1183140513 22:35934071-35934093 CTGTAAAAGACCGGGCAAGAAGG + Intronic
1183457956 22:37932953-37932975 CTGTTACTGATGAGGGAAGAGGG - Intronic
1183746258 22:39693810-39693832 CAGAAAGAGAGGAGGGGAGATGG - Intergenic
1184874050 22:47261514-47261536 GGGTCAGAGAGGAGGGAAGATGG - Intergenic
1185307062 22:50125103-50125125 CTGAAAAAGAGCAGGGAGGGTGG + Intronic
949336509 3:2980961-2980983 CTGGCAAAGAGAAGGGACGATGG + Intronic
949362868 3:3250109-3250131 CTGTCAAGGAGCTGGGAAGAGGG + Intergenic
949634426 3:5967498-5967520 ATGAAAAAAAGGAGGGAAGGAGG - Intergenic
949642083 3:6047984-6048006 CTGGCAAAGAGAAAGGAAGAGGG - Intergenic
949797254 3:7864481-7864503 CGGTGAAAGAGGGGGCAAGAGGG - Intergenic
950401604 3:12773266-12773288 GAATAAAAGAGGAGGGGAGAGGG + Intergenic
950591271 3:13937110-13937132 CTATAAAAGATGTGGGATGAGGG - Intergenic
950712330 3:14821226-14821248 CTATAAAAGATGAGGGAGGAGGG - Exonic
950989860 3:17421968-17421990 AAGTAGAAGAGGAGGGAGGAAGG - Intronic
951615584 3:24539996-24540018 CTGAAGAAAAGGAGGGAAGAGGG - Intergenic
951700851 3:25495238-25495260 GGGTATCAGAGGAGGGAAGATGG + Intronic
952051317 3:29387893-29387915 CAGTAAATTAGGAGAGAAGAAGG - Intronic
952158503 3:30669671-30669693 CTGACAAAGAGAAGGGAAGATGG + Intronic
952618732 3:35309154-35309176 CTATAAAAGAGAATGGAATAAGG - Intergenic
952704812 3:36366507-36366529 CTGGCAAAGAGAAGGGAAGATGG + Intergenic
952711890 3:36439940-36439962 CTGTCAAAGAAGGGGGAAGAAGG - Intronic
953902207 3:46849772-46849794 CTGGAAAAGAGGTTGGAGGAGGG + Intergenic
954758932 3:52860353-52860375 CTGTCAATGAGGAGGTATGAAGG + Intronic
955044404 3:55346445-55346467 TTCTAAAAGATGAGGGAAGCAGG + Intergenic
955461151 3:59184513-59184535 GTGAAAAAAAGGAAGGAAGAAGG + Intergenic
955568601 3:60277483-60277505 CTGGCAAAGAAAAGGGAAGATGG - Intronic
955609508 3:60742106-60742128 CTGTAAAATAGCGGGGAAGTAGG + Intronic
955917914 3:63925167-63925189 CTGTGAAGGAAGAGGGAAGTTGG + Intronic
956838782 3:73117725-73117747 CAGAAAGAAAGGAGGGAAGAGGG - Intergenic
957036379 3:75297049-75297071 CTGTGAGTGTGGAGGGAAGAAGG - Intergenic
957155761 3:76542005-76542027 GTGGCAGAGAGGAGGGAAGAAGG - Intronic
957989444 3:87610961-87610983 CTTTTCAAGAGGGGGGAAGATGG + Intergenic
958558503 3:95710531-95710553 CTGACAAAGAGAAGGGAAGATGG + Intergenic
958735755 3:98007628-98007650 CTGTAAAAGGAGAGGAATGATGG + Intronic
959280049 3:104325837-104325859 CTGTAAAGGAGTAGACAAGATGG + Intergenic
959376768 3:105597781-105597803 ATATAAAAGAGGAGGAAATATGG - Intergenic
959519336 3:107307455-107307477 CTGAGAAACAGGAGGGCAGAAGG + Intergenic
960619900 3:119627659-119627681 CTGAAAAAGAGGAAAGAAGGAGG - Intronic
961324711 3:126103334-126103356 CTGGGAAACAGGTGGGAAGACGG - Intergenic
961414149 3:126745195-126745217 TTATTAAAGAAGAGGGAAGAGGG + Intronic
961500392 3:127328464-127328486 CTGGAAAATTGGAGGAAAGAGGG + Intergenic
961587861 3:127948859-127948881 CAGTGAAAGGGGAGGAAAGAGGG + Intronic
961619134 3:128209526-128209548 CTGTAAGAGAGATGTGAAGATGG - Intronic
961635778 3:128331447-128331469 CTGAGGAAGGGGAGGGAAGAGGG - Intronic
962403163 3:135078634-135078656 CTGTGAAAGAGAGAGGAAGAGGG + Intronic
963004641 3:140715119-140715141 TTGACAAAGAGAAGGGAAGATGG - Intergenic
963034039 3:141009656-141009678 CTTTAAAGCAGGTGGGAAGAGGG + Intergenic
963173894 3:142279177-142279199 CTGACAAAGAGAAGGGAAGATGG - Intergenic
963502023 3:146139215-146139237 GTGAAAAAGAGCAGTGAAGAAGG + Intronic
963879382 3:150511732-150511754 CTGAGAAAGAGCAGGGAAGGAGG + Intergenic
963893156 3:150658420-150658442 CTGGCAAAGAGAAGGGAAGATGG - Intergenic
964028306 3:152105038-152105060 ATGGAAAAGAGGAAGGAAAAGGG - Intergenic
964147996 3:153489354-153489376 TTGTAGAGGTGGAGGGAAGAAGG - Intronic
964327165 3:155559787-155559809 CTGGAAAACAGGAAGTAAGAAGG + Intronic
964357910 3:155867388-155867410 CTGTCAAAGAGGAGGTAACAGGG + Intergenic
964366144 3:155952658-155952680 TTGGCAAAGAAGAGGGAAGATGG + Intergenic
964962193 3:162440152-162440174 CTGACAAAGAGAAGGGAAGATGG + Intergenic
964986626 3:162749296-162749318 CTGAAAAAAAGGATGGAAAAAGG - Intergenic
965029258 3:163342290-163342312 CTGACAAAGAGGAGGAAAAAAGG - Intergenic
965079539 3:164019675-164019697 GTGAGAAGGAGGAGGGAAGAGGG + Intergenic
965630380 3:170726706-170726728 GTGTAGAAGAGGAGGGAAACTGG - Intronic
965687831 3:171324140-171324162 GTGAAAGAGAGGAGGGAGGAAGG + Intronic
965698564 3:171436151-171436173 CTGTATAGGAGTGGGGAAGATGG - Intronic
965774249 3:172211594-172211616 CTGTAGAAGAGGAGGGCTGATGG + Intronic
965785074 3:172326976-172326998 CAGAAATAGAGGAGGAAAGAAGG + Intronic
966043226 3:175518013-175518035 CTGGAAAGGAGGAGAGAAGATGG + Intronic
966350082 3:179024141-179024163 GGAAAAAAGAGGAGGGAAGAAGG + Exonic
966369650 3:179235547-179235569 TTATAAAAGAGAATGGAAGACGG - Exonic
966521745 3:180881197-180881219 CTGACAAAGAGAAGGGAAGACGG - Intronic
966770045 3:183495765-183495787 TTGAAAAAGAAAAGGGAAGAAGG + Intronic
967070133 3:185955729-185955751 CTGGCAAAGAGAAGGGAAGATGG + Intergenic
967094738 3:186168055-186168077 GTTGAAAAGAGGAAGGAAGAAGG + Intronic
967828255 3:193896248-193896270 TTGAAAGAGAGAAGGGAAGAGGG + Intergenic
968877449 4:3280480-3280502 CTGTAAAAGTGTAGGAAAGCTGG + Intergenic
968881234 4:3301193-3301215 ATGTAACAGAGGAGGGCAGCCGG - Intronic
969031472 4:4218471-4218493 ATGGAAAAGGAGAGGGAAGAAGG + Intronic
969082734 4:4632340-4632362 CTGTAGGAGAAGAGGGAAAAGGG - Intergenic
969640966 4:8398424-8398446 CTCTAAATGAGAGGGGAAGAAGG - Intronic
970417132 4:15870285-15870307 CTGACAAACAGAAGGGAAGATGG - Intergenic
970573357 4:17404278-17404300 CTTTAAAAAGGGAAGGAAGAAGG + Intergenic
971408633 4:26346474-26346496 CTGACAAAGAGAAGGGAAGATGG + Intronic
972041313 4:34603717-34603739 CTAACAAAGAGAAGGGAAGATGG + Intergenic
972053566 4:34771656-34771678 CTGGCAAAGAGAATGGAAGACGG - Intergenic
972179506 4:36446181-36446203 CTGGCAAAGAGAAGAGAAGATGG + Intergenic
972204921 4:36760006-36760028 CTGGCAAAGAGAAGAGAAGATGG + Intergenic
972271017 4:37510934-37510956 TTGTGAAAGGGGAGGGAAGAAGG - Intronic
972396052 4:38660802-38660824 ATGGTGAAGAGGAGGGAAGAGGG - Intergenic
972564786 4:40259994-40260016 CTGGCAAAGAGAAGGGAAGATGG + Intergenic
972636239 4:40886533-40886555 CTGTAAAAGAATAAGGAGGAAGG + Intronic
975257091 4:72250157-72250179 AAGTAGAAGAGGAGGAAAGAAGG - Intergenic
975264267 4:72343237-72343259 CTGGCAAAGAGAAGGGAAGATGG + Intronic
975273946 4:72473259-72473281 CTCTAAAGGTGGAGAGAAGAAGG + Intronic
975681792 4:76884811-76884833 TTGTAAAAGAAGAGGAAACAAGG + Intergenic
976252676 4:83069219-83069241 GTGTAAATGAGGTGGGAATAAGG - Intronic
976575587 4:86666867-86666889 CTGGCAAAGAGAAGGGAAGATGG + Intronic
976786469 4:88826986-88827008 CTGTAAGTGGGGAAGGAAGAGGG - Intronic
977226574 4:94398894-94398916 CAGAAATGGAGGAGGGAAGAGGG - Intergenic
977600238 4:98928278-98928300 CTGTCATGGAGGAGGGAAGGGGG - Intronic
977614309 4:99070395-99070417 AGGTAAAACAGGAGGGAAGCTGG + Intergenic
977891532 4:102317755-102317777 CTGTAAAATAGGAGGAAAACGGG + Intronic
978068199 4:104432517-104432539 CTGCAAAAGAGGACTGAAAATGG + Intergenic
978169212 4:105649034-105649056 AAGTAAAACAGGATGGAAGAAGG - Intronic
978200194 4:106016758-106016780 CAGTACAAGGGGAGGAAAGAAGG + Intergenic
979277969 4:118835020-118835042 CTGAAAAAGAGGAGAGAGGCAGG + Intronic
980344299 4:131593121-131593143 GTGTAAGACAGCAGGGAAGATGG - Intergenic
980478885 4:133358610-133358632 CTGTAAAAAATAATGGAAGATGG + Intergenic
980709340 4:136543862-136543884 TTCTGAGAGAGGAGGGAAGACGG + Intergenic
981348879 4:143705130-143705152 GTGTGAAAAAAGAGGGAAGAGGG + Intergenic
981903534 4:149893589-149893611 CAGAGAAAGAGGAGGAAAGAAGG - Intergenic
981927502 4:150155888-150155910 ATGTAAAGCAGGAAGGAAGAAGG + Intronic
982460201 4:155660448-155660470 TTGTAGAAAAGGAGGGAAGAAGG - Intergenic
982671670 4:158327622-158327644 CTGACAAAGAGAAGGGAAGGTGG - Intronic
983138797 4:164122405-164122427 CTGACAAAGAGAAGGAAAGATGG - Intronic
983270625 4:165557474-165557496 CTTACAAAGAGAAGGGAAGATGG + Intergenic
983271622 4:165568743-165568765 CTGTAAAAGGGAAGGAGAGATGG + Intergenic
983559772 4:169089075-169089097 CTGACAAAGAGAAGGGAAGATGG - Intergenic
983706153 4:170662279-170662301 CTAACAAAGAGAAGGGAAGATGG - Intergenic
984111083 4:175615137-175615159 CTGACAAAGAGAAGGGAAGATGG + Intergenic
984261972 4:177453378-177453400 AAGTAAAAGAGAAGGGAGGAAGG - Intergenic
984323236 4:178221311-178221333 CTGTAAAAGGGAAGAAAAGAAGG + Intergenic
984381509 4:178998240-178998262 CTCTAAAAGTGGAGGGAAGATGG - Intergenic
985054366 4:186023514-186023536 CTATAAAAAAGGAGGAAAGACGG - Intergenic
985382936 4:189414292-189414314 GTCTAAAAGAGGAAGGAAGAAGG + Intergenic
985400130 4:189586029-189586051 TTGACAAAGAGAAGGGAAGATGG - Intergenic
985721139 5:1489859-1489881 CTGGAAGAGAGGAGGGGAGACGG + Intronic
986033202 5:3912279-3912301 CTGCAAATGAGGAGGTAAAATGG - Intergenic
986231582 5:5869101-5869123 CTTTATAAGAGGAAGGCAGAGGG - Intergenic
986252752 5:6075737-6075759 ATAGAAAGGAGGAGGGAAGAAGG - Intergenic
986332400 5:6727182-6727204 GTGGAAAAGGGAAGGGAAGAGGG - Intronic
988303844 5:29468979-29469001 TTGTAAAGGAGGAGTGATGATGG - Intergenic
988618953 5:32802869-32802891 CTGTAAATGTGCAGAGAAGATGG + Intergenic
988787146 5:34575552-34575574 CTGTCAAAGAAGAGGGGTGATGG - Intergenic
989135191 5:38147265-38147287 ACATCAAAGAGGAGGGAAGAGGG - Intergenic
990177219 5:53121500-53121522 TTGTAAAATATTAGGGAAGATGG + Intergenic
990766198 5:59186056-59186078 GAGAAAGAGAGGAGGGAAGAAGG - Intronic
991106125 5:62843991-62844013 TTGGCAAAGAGAAGGGAAGATGG - Intergenic
991313775 5:65276290-65276312 CTGTAAAAGAGAAGTTAATATGG - Intronic
992416411 5:76556300-76556322 CTGTAAAGGAGCAGACAAGATGG - Intronic
992559457 5:77936005-77936027 CTGTAAAAGAGGAGAGCAAATGG - Intergenic
992591827 5:78303533-78303555 CCTTAAAAGAGGAAGGCAGAAGG - Intergenic
992750557 5:79857007-79857029 CAGTCAGAGAGGAGGAAAGATGG + Intergenic
993903454 5:93599276-93599298 GTGAAAAGGAGGAAGGAAGAAGG + Intergenic
993930140 5:93927813-93927835 GTAAAAAAGAGGAGGGGAGAGGG + Intronic
994099879 5:95880745-95880767 CAGAGAAAGAGGAGGGAAGGAGG + Intergenic
994687226 5:102970423-102970445 TTGTAAAGGAAGAGAGAAGATGG + Intronic
994950218 5:106452305-106452327 TTCTAAAAGAGGAAGGATGAGGG + Intergenic
995310663 5:110707071-110707093 TTGTAAAAGTGGAAGCAAGATGG + Intronic
995374769 5:111461695-111461717 CTGGGAAGGAGGAGGGAGGAGGG - Intronic
996211888 5:120820074-120820096 CTGAGAAAGAGAAGGGAAGGTGG + Intergenic
996477583 5:123938464-123938486 CTGTAAAGGAGCAGACAAGATGG - Intergenic
996551273 5:124732942-124732964 CTGTATAGAGGGAGGGAAGAAGG - Intronic
997497432 5:134341727-134341749 TTGGCAAAGAGAAGGGAAGATGG - Intronic
997639207 5:135437586-135437608 CTGTTTCAGGGGAGGGAAGAGGG - Intergenic
997775929 5:136604993-136605015 CAGAAAAAGAGGAAGGAAGGTGG - Intergenic
998741026 5:145201967-145201989 GTGTAGAAGAGGAGGGGTGATGG - Intergenic
998878821 5:146626953-146626975 ATGGAAATGAGGATGGAAGAAGG + Intronic
999145326 5:149389445-149389467 CTGTAAAAGAGAGGAGATGATGG - Intronic
999322042 5:150621496-150621518 CTGGAGATCAGGAGGGAAGAAGG + Intronic
999418761 5:151422346-151422368 TTGTAAAAGACGTGGGATGAAGG + Intergenic
1000671672 5:164070978-164071000 CTGTAAAATATGAGAAAAGATGG - Intergenic
1000854087 5:166378350-166378372 CTGACAAAGAGAAGGGAAGATGG + Intergenic
1001334488 5:170785988-170786010 ATGCAAAAGAGCAGGGAGGATGG - Intronic
1001730363 5:173949937-173949959 CTGGAAAAAAGGGGGAAAGAAGG - Intronic
1001919425 5:175588699-175588721 GAGAAAAGGAGGAGGGAAGAAGG + Intergenic
1002625102 5:180521178-180521200 GTGTGAAAGAGGAGGAAAGAGGG + Intronic
1003870525 6:10399131-10399153 CTCTAGAGGAGCAGGGAAGAGGG - Intronic
1004614085 6:17273194-17273216 CTGACAAAGAGAAGGGAAGATGG - Intergenic
1004744834 6:18499441-18499463 CTGAGAAGGAGGAGGGAAGGTGG + Intergenic
1004745726 6:18507285-18507307 CTGACAAAGAGAAGGGAAGATGG + Intergenic
1005181144 6:23108376-23108398 CTGATAAAGAGAAGGGAAGATGG + Intergenic
1005356988 6:24994571-24994593 CTGTAGAAGAGCAAAGAAGAAGG + Intronic
1005785043 6:29236339-29236361 CTGACAAAGAGAAGGGAAGATGG + Intergenic
1005856312 6:29865632-29865654 CTGTACACTGGGAGGGAAGATGG + Intergenic
1006024451 6:31138307-31138329 CTGTAAAGGAGGAAGGAGAAAGG + Intronic
1006042182 6:31265702-31265724 CTGGCAAAAAGAAGGGAAGATGG + Intergenic
1006051771 6:31350812-31350834 CTGGCAAAGAGAAGGGAAGATGG + Intronic
1006607362 6:35267792-35267814 ATGTCAAAGATGAGGCAAGATGG + Intronic
1006763959 6:36488413-36488435 ATGGAGAACAGGAGGGAAGATGG - Exonic
1006832954 6:36979831-36979853 CTGTAAAAAAAGAAGGAATAAGG + Intronic
1007038278 6:38698337-38698359 ATGGAAAGGAGGAAGGAAGAAGG - Intronic
1007111896 6:39317650-39317672 CTGTGAAAGAGGAAGGGTGAAGG - Intronic
1007359823 6:41346869-41346891 GAGAAAAAGAGGAGGGAAGAAGG + Intronic
1007519286 6:42439046-42439068 CTGAAAAAGAGCAGGCGAGATGG + Intronic
1007687311 6:43674531-43674553 ATGCCAGAGAGGAGGGAAGAAGG + Intronic
1007776986 6:44229367-44229389 CTGCAATGGAGGAGGAAAGATGG - Intronic
1007910656 6:45510864-45510886 CTGTAAAAGGTGAGGAAGGAGGG - Intronic
1008701046 6:54100401-54100423 CAGTAACATAGGATGGAAGAAGG - Intronic
1008904482 6:56661438-56661460 CTGTAAAGCTTGAGGGAAGATGG - Intronic
1009413586 6:63393478-63393500 CTGTACAGAAGAAGGGAAGATGG - Intergenic
1009566551 6:65318248-65318270 CTGGAAAAGAGGAGTGAGAAGGG - Intronic
1009657184 6:66562267-66562289 CTGGCAAAGAGAATGGAAGATGG + Intergenic
1009770751 6:68140415-68140437 CTGGCAAAGAGTAGGGATGATGG - Intergenic
1009844457 6:69118489-69118511 AGGTAAAGGAGGAGAGAAGATGG - Intronic
1010784030 6:79979030-79979052 CTGTGCTAGATGAGGGAAGATGG - Intergenic
1011038010 6:82999116-82999138 CTGTAAGATAGGAGTAAAGAGGG - Intronic
1011362003 6:86537244-86537266 GTGTAAAAGAGGGGGAGAGAGGG - Intergenic
1011488627 6:87868760-87868782 CTGGGTGAGAGGAGGGAAGAAGG - Intergenic
1011552146 6:88539734-88539756 ATGTAAAAGAGCAGGGAATGCGG + Intergenic
1011595246 6:89009817-89009839 CCGAGAAAGAGAAGGGAAGATGG - Intergenic
1011888474 6:92127202-92127224 CTGTCAAAGAGAAGGGAAGGTGG - Intergenic
1012574999 6:100783945-100783967 CTTTTAAAGAGGGGGGAAGTAGG + Intronic
1012734401 6:102920680-102920702 CTGGCAAAGAGAAGGGAAAATGG - Intergenic
1013007481 6:106087503-106087525 CAGGAAAAGAGGAGGAAAAATGG - Intronic
1013315702 6:108940582-108940604 CTAGCAAAGAGAAGGGAAGATGG + Intronic
1013435789 6:110105025-110105047 ATATAAAATAGGAGTGAAGAAGG - Intronic
1013700463 6:112762946-112762968 CTGTAAAATAGGAGAGAAAAAGG + Intergenic
1013760515 6:113512136-113512158 CTGGAAAAGAGGAAGAAAGAGGG - Intergenic
1013776711 6:113687077-113687099 CTGTAAAAGGCAAGGGAATATGG - Intergenic
1014202887 6:118624394-118624416 GTAGAAAGGAGGAGGGAAGAAGG - Intronic
1014495002 6:122110616-122110638 CTGAAAAAGGGAAGGAAAGAAGG + Intergenic
1014683392 6:124463599-124463621 TTGGAAGGGAGGAGGGAAGAAGG - Intronic
1014848727 6:126313507-126313529 CAGTGTCAGAGGAGGGAAGAGGG - Intergenic
1015211191 6:130701140-130701162 CTGAAAGAGGGGAGGGAGGAAGG + Intergenic
1015566613 6:134579201-134579223 TTGTAGAAGAGGGGGAAAGAGGG + Intergenic
1016104536 6:140145900-140145922 CTGACAAACAGAAGGGAAGAGGG + Intergenic
1016909746 6:149186191-149186213 CAGTGAAAGAGCAGGGTAGAGGG - Intergenic
1017097543 6:150817926-150817948 CTGTGAAAGAGGAGGGAGGGAGG - Intronic
1017594677 6:156015652-156015674 TGGTAAGAGAGGAGGCAAGAGGG - Intergenic
1017627084 6:156359629-156359651 CTGGCAAAGAGGAGGGAAGATGG - Intergenic
1017730170 6:157308632-157308654 CAGCAGAAGAGGAGGCAAGACGG + Intronic
1017945809 6:159095546-159095568 TTGTCAAAGAACAGGGAAGAAGG + Intergenic
1018388886 6:163328240-163328262 CTGACAAAGAGAAGGGAAGATGG + Intergenic
1019224288 6:170497524-170497546 CTGTTAAAAAGGAGGGATAATGG - Intergenic
1019848893 7:3534859-3534881 CTGATAAAGAGAAGGGAAGATGG - Intronic
1019854183 7:3587572-3587594 CTGAAAAAGCGGAGGAAAGTTGG - Intronic
1019940755 7:4287770-4287792 CTGAAAAAGAAGAGTGAAGTGGG - Intergenic
1020152240 7:5691516-5691538 GTGTAGAAGAGAAGGGGAGAGGG + Intronic
1020563500 7:9766439-9766461 CTGTCACAGAGAAGGGAATAGGG - Intergenic
1020739487 7:11995939-11995961 CAATACAAGAGGAGGGAGGAAGG - Intergenic
1020782243 7:12532081-12532103 CTGGCAAAGGGAAGGGAAGATGG + Intergenic
1020991014 7:15196046-15196068 CTGTCAAAAAGGAGAGGAGAGGG - Intergenic
1021239050 7:18178086-18178108 CTGTCAAAGAGGAGAGGGGAGGG - Intronic
1021265610 7:18517480-18517502 CTGTAAAAGAGGAGAAATGGAGG - Intronic
1021367113 7:19793253-19793275 CTGATAAAGAGAAGGGAAGAAGG + Intergenic
1021416130 7:20387213-20387235 TTATAAATGAGGAGGGAAAAAGG + Intronic
1021745028 7:23731585-23731607 CTGGAAAAGGGGAAGGAAGGAGG - Intronic
1022592017 7:31672715-31672737 CTGACAAAGAGGAGTGATGATGG - Intergenic
1022852943 7:34283671-34283693 CTGGCAAAGAGAAGGGAAGATGG - Intergenic
1023062626 7:36343324-36343346 CTGTAGGAGAGGAGAGGAGAGGG + Intronic
1023281761 7:38577825-38577847 AAGGAAAGGAGGAGGGAAGACGG + Intronic
1023318991 7:38973514-38973536 TTTTAAAAGAGAAGGGGAGAAGG - Intergenic
1023591339 7:41783635-41783657 CTGTAGATGTGGAGAGAAGACGG + Intergenic
1023675281 7:42622282-42622304 CTGTAAAGCAGGAGGAAATATGG + Intergenic
1023770661 7:43553840-43553862 TTGTGCAAGTGGAGGGAAGAAGG - Intronic
1024434060 7:49328146-49328168 CAGAAAAAGAGGAGAGAAAAGGG + Intergenic
1024752112 7:52478593-52478615 CTGTTAAAGAGAAGGGAAGATGG + Intergenic
1024770503 7:52715985-52716007 CTGGCAAAGAGAAGGGACGATGG + Intergenic
1026183325 7:68061320-68061342 CTGGCAAAGAGAAGGGAAGATGG + Intergenic
1026274260 7:68863028-68863050 CTGGCAAAGAGAAGGGAAGATGG + Intergenic
1026321481 7:69271718-69271740 CAGAAAAAGAGGAAGGAAAAAGG - Intergenic
1026594121 7:71720025-71720047 TTGGCAAAGAGAAGGGAAGATGG - Intergenic
1026618914 7:71933167-71933189 CTGGCAAAGAGGAGGGAAGATGG - Intronic
1026624865 7:71982917-71982939 TTGGCAAAGAGAAGGGAAGATGG - Intronic
1028679167 7:93505835-93505857 CTGGCAAAGAGAAGGGAAGGTGG - Intronic
1028898785 7:96072357-96072379 CTGTTAAAGAAAAGGGAAAAAGG - Intronic
1030520057 7:110587649-110587671 CCATAAAAGAGTAGGTAAGATGG + Intergenic
1030769192 7:113452668-113452690 GTGAAAAAGAAGAGGGAAAATGG + Intergenic
1031182689 7:118436919-118436941 GTGAAAAAGAGAAGGGAAGATGG + Intergenic
1031246122 7:119313976-119313998 CTTTAAATGAAGAGGGAACATGG + Intergenic
1031340046 7:120588708-120588730 CTCTAAAAGAGGGTGGAGGAAGG + Intronic
1031351923 7:120743507-120743529 CTGGAAAAGAGCAGCGAACATGG + Intronic
1031534352 7:122915061-122915083 CTGATAATGAGAAGGGAAGATGG + Intergenic
1031757195 7:125660087-125660109 CTGGCAAAGAGAAGGGAAGATGG - Intergenic
1031913271 7:127539728-127539750 CTGGCAAAGAGAAGGGAACATGG - Intergenic
1032659975 7:133972118-133972140 CTGTAAAACAGGAGTAAAGATGG - Intronic
1032804326 7:135339976-135339998 CTGCAAAAAAGGAGAGAATAAGG - Intergenic
1032812001 7:135429375-135429397 TTGTAGAGGAGGAGGGAAAATGG - Intronic
1032860063 7:135868242-135868264 CTCTAAAAAAGGAAGGGAGAGGG + Intergenic
1032891908 7:136205805-136205827 CTGAGAAAGAGGTGGGAAGTAGG + Intergenic
1033449351 7:141448927-141448949 GTGAACAGGAGGAGGGAAGAGGG + Intronic
1033459029 7:141528734-141528756 CTGTTGGAGAGGAGGGGAGATGG - Intergenic
1035816814 8:2550173-2550195 CTGTAAAACAGGAGCAATGATGG + Intergenic
1036451584 8:8872380-8872402 CTGTAAAAGGGGACGGCAGGAGG + Intronic
1036515364 8:9438730-9438752 CTGTAAAGGAGAAGGGAAGGTGG + Intergenic
1036546776 8:9778686-9778708 CAGCAAAAGAGAAGGAAAGAAGG - Exonic
1037090792 8:14915533-14915555 CTGACAAAGAGGAGGGAAGATGG - Intronic
1037097248 8:15000590-15000612 CTGGCAAAGAGAAGCGAAGATGG - Intronic
1037221575 8:16528922-16528944 CTGGCAAAGAGAAGAGAAGATGG + Intronic
1037373396 8:18203951-18203973 CTGTAAAGGAGCAGACAAGATGG + Intronic
1037415042 8:18640722-18640744 CAGTAAGACTGGAGGGAAGATGG + Intronic
1037449612 8:19003622-19003644 TTTTAAAAGAGGAGGGAAGAAGG + Intronic
1037458622 8:19086916-19086938 CTGTACCTGAGGAGGAAAGAAGG + Intergenic
1037504712 8:19518355-19518377 CTGATAAAGAGAAGGGAAGATGG - Intronic
1037713737 8:21378168-21378190 TTCCAAAAGAGGAGGGAGGAAGG - Intergenic
1037897616 8:22668734-22668756 GTTTAAAAAAGGAGGGAACAAGG + Intronic
1038370066 8:26980115-26980137 CTGACAAAGAGAAGGGAAGGTGG - Intergenic
1038506751 8:28091303-28091325 CTAAAAAGGAGGAGGGAATAAGG + Intronic
1038655225 8:29444674-29444696 CTTTTAAAGAAGAGGGAAAATGG + Intergenic
1038983720 8:32786412-32786434 CTGGAAAGGAGAAGGGAAGACGG + Intergenic
1039421165 8:37442392-37442414 ATGGAAGACAGGAGGGAAGAAGG - Intergenic
1039522833 8:38185939-38185961 CTGCAAAAAAGGAGGGATGGAGG - Intronic
1039610293 8:38914066-38914088 CAGTAAAAGAGGTGGTGAGAAGG - Intronic
1040356838 8:46626821-46626843 CTGACAAAGAGAAGGGAAGATGG - Intergenic
1040491711 8:47929349-47929371 CAGAACAAGAGGAGGGAAGGTGG + Intronic
1040525906 8:48225174-48225196 CTGTAAAGGAGCAGAGAAGGTGG + Intergenic
1040528346 8:48244106-48244128 CTGTAAAGGAGCAGACAAGATGG + Intergenic
1041094973 8:54341227-54341249 ATGTAAAACAAGAGAGAAGATGG + Intergenic
1041846143 8:62331033-62331055 AGGTAGAAGAGGAGGGAGGAAGG - Intronic
1042104884 8:65315797-65315819 CTGTGGAAGAGGATGGCAGAAGG - Intergenic
1042665139 8:71196070-71196092 CTGGCAAAGAGAAGGGAATATGG - Intergenic
1042962851 8:74321444-74321466 CGGCAAAAGAGGAGGGAGGACGG - Intronic
1043005317 8:74811267-74811289 CTGACAAGGAGAAGGGAAGAAGG - Intronic
1043243489 8:77967407-77967429 ATGGAAAAGAGGTGGGAGGAGGG + Intergenic
1044629612 8:94265706-94265728 CTCTAAGAGAGGAGAGATGATGG + Intergenic
1044656920 8:94557938-94557960 TTGGAAAAGAAAAGGGAAGATGG + Intergenic
1044787502 8:95809996-95810018 CTGTGAAAGAAGAGAGAAAAGGG - Intergenic
1045203191 8:100008570-100008592 CTGAAGGAGAAGAGGGAAGAAGG + Intronic
1045497848 8:102723241-102723263 CTGTAAAAGAGGAAGAATAATGG - Intergenic
1045523275 8:102921577-102921599 CTGTCAAAAAGAAGGGAAGGAGG - Intronic
1045681672 8:104667290-104667312 CTGATAAAGAGAAGGGAAGATGG - Intronic
1045794822 8:106030221-106030243 CTGGCAAAGAGAAGGGATGATGG + Intergenic
1046004378 8:108461679-108461701 CTTTAAAAAAGATGGGAAGAAGG - Intronic
1046263065 8:111796295-111796317 CTGACAAAGAGAAAGGAAGACGG - Intergenic
1046320368 8:112566720-112566742 CTGGCAAAGAGAAGAGAAGAAGG - Intronic
1046643265 8:116755923-116755945 CTGGAAAACAGGAGGGAGGCGGG - Intronic
1046885217 8:119359597-119359619 ATGGAAAAGAAGAGGGAAAATGG - Intergenic
1046952663 8:120032991-120033013 CAGTAAAAGAGAAGTGAGGATGG + Intronic
1047124526 8:121945950-121945972 CTTTATAAGAGGAGGGCAGGAGG - Intergenic
1047368873 8:124238357-124238379 CTGTATGTGAGGAGGGAAGGTGG - Intergenic
1047399442 8:124533534-124533556 CTGCAAAAAAGGAGGGGAGCTGG + Intronic
1047647686 8:126886163-126886185 GTGTTTAAGAAGAGGGAAGAAGG - Intergenic
1047685299 8:127299046-127299068 TTGGCAAAGAGAAGGGAAGATGG + Intergenic
1047928615 8:129704461-129704483 CAGGAAAAAAGGAGGGAAGAAGG - Intergenic
1047981526 8:130188184-130188206 CTGAAAAAGCAAAGGGAAGATGG + Intronic
1048052388 8:130830273-130830295 CTGACAAAGAGAAGGGAAGATGG - Intronic
1048552062 8:135442643-135442665 GAATAAAAGAGGAGGGAAAAAGG + Intergenic
1048876642 8:138841678-138841700 TTGACGAAGAGGAGGGAAGAGGG + Intronic
1049453092 8:142672981-142673003 CTGGCAAAGAGAAGGGAAGATGG + Intronic
1050155757 9:2664871-2664893 CAGTAAAGGAGAAGGGGAGAGGG - Intergenic
1052031342 9:23632486-23632508 CAATAAAAGAATAGGGAAGAGGG - Intergenic
1052599717 9:30610008-30610030 CTGGATAAAAGAAGGGAAGAAGG + Intergenic
1053160088 9:35808108-35808130 CTGTCAGAGAGGAGGAAAGCAGG - Exonic
1053316540 9:37056745-37056767 CTTAAAAAGTGGAGGGGAGAGGG + Intergenic
1055018543 9:71645053-71645075 AGGAAAGAGAGGAGGGAAGAGGG - Intergenic
1055042966 9:71895220-71895242 CTGTAAATGGGGTGGGAGGAGGG - Intronic
1055068230 9:72140381-72140403 CGGGAAAAGAGGAGGAAAGAGGG + Intronic
1055295115 9:74826082-74826104 CTGTACCAAAGGAGGGAAAAAGG + Intronic
1055587401 9:77769515-77769537 CTGTAACACAGGCAGGAAGAAGG + Intronic
1055986517 9:82060142-82060164 CTGGGAAAGAGGATTGAAGATGG + Intergenic
1056008147 9:82296114-82296136 GTGAAAAAGAGGATGGGAGAAGG - Intergenic
1056520727 9:87398896-87398918 CTGACAAAGAGAAGGGAAGATGG + Intergenic
1056577761 9:87869089-87869111 CTGTAGGAGAAGAGAGAAGATGG + Intergenic
1056584827 9:87920990-87921012 CTGGGAAAGAGGATTGAAGATGG - Intergenic
1056612054 9:88131950-88131972 CTGGGAAAGAGGATTGAAGATGG + Intergenic
1057160648 9:92886043-92886065 CTGGGAAAGAGGATTGAAGATGG - Intergenic
1057404146 9:94752718-94752740 CTGTAGAAAAGCATGGAAGATGG - Intronic
1057918241 9:99074144-99074166 CTGGCAAAGAGAAGGGAACATGG - Intergenic
1058049988 9:100395694-100395716 CTGGCAAAGAGAAGGGAACATGG + Intergenic
1058681034 9:107440422-107440444 CTTTAAAAGAGGAAAGGAGAGGG + Intergenic
1058860114 9:109108059-109108081 CTGGATAAGAGGAGGGAACTGGG - Intronic
1059458725 9:114416087-114416109 GGGGACAAGAGGAGGGAAGAAGG + Intronic
1059892297 9:118816639-118816661 CTGACAAAGAGAAGGGAAGATGG + Intergenic
1061001777 9:127906713-127906735 CTGCAAAACAGGAAGGCAGAGGG - Intergenic
1062340971 9:136093924-136093946 CTGGAGAACAGGAGGGAAGGAGG + Intronic
1185552037 X:990217-990239 TTGACAAAGAGGAGGGAAGATGG - Intergenic
1185713819 X:2325470-2325492 CTGACAAAGAGGAGGGAAGATGG - Intronic
1185726685 X:2427278-2427300 AGGGAAGAGAGGAGGGAAGAAGG + Intronic
1186598052 X:11006147-11006169 GTGGATGAGAGGAGGGAAGAAGG - Intergenic
1187370021 X:18697460-18697482 GAGGAAAAGAGGTGGGAAGAGGG - Intronic
1189074022 X:37897182-37897204 CTATAAAAGATGAGGGCAGAGGG + Intronic
1189580822 X:42404390-42404412 CTGACAAAGAGAAGGGAAGATGG + Intergenic
1189871028 X:45382820-45382842 GTGTTAAAAAGGATGGAAGATGG - Intergenic
1189891123 X:45603620-45603642 TGGTAAGAGAGGGGGGAAGAGGG - Intergenic
1190525367 X:51324296-51324318 CTGTGAAAGAGGGGAAAAGAGGG - Intergenic
1191054984 X:56232309-56232331 CTGAGAAGGAGGAGGGAGGAAGG - Intergenic
1191741373 X:64438829-64438851 CTAACAAAGAGAAGGGAAGATGG - Intergenic
1192746427 X:73943388-73943410 AAATAAAAGAAGAGGGAAGATGG + Intergenic
1193772360 X:85603327-85603349 CTAGCAAAGAGAAGGGAAGATGG - Intergenic
1193790633 X:85812124-85812146 CTGATAAAGAGAAGGGAAGCTGG - Intergenic
1193791424 X:85819888-85819910 CTGATAAAGAGAAGGGAAGATGG - Intergenic
1194097483 X:89660339-89660361 TTCTAAAAGAGGAGGGCATATGG - Intergenic
1194482147 X:94439722-94439744 CTGACAAAGAGAAAGGAAGATGG + Intergenic
1195106125 X:101603049-101603071 CTCTCAAAGAGGAGGGAAGGAGG + Intergenic
1195159140 X:102154592-102154614 CTGTATCTGATGAGGGAAGAAGG - Intronic
1196927998 X:120653114-120653136 CTGACGAAGAGAAGGGAAGATGG - Intergenic
1196931185 X:120683578-120683600 CAGTGAAAGAGGTGGGGAGATGG + Intergenic
1197240892 X:124122103-124122125 CTGACAAAGAGAAGGGAAGATGG - Intronic
1197337045 X:125221068-125221090 CTGGCAAAGAGAAGGGAAGATGG + Intergenic
1197356354 X:125440520-125440542 CTGACAAAGAGAAGGGAAGATGG + Intergenic
1197714901 X:129699552-129699574 CTGTAAGAGAGAAGTGAACATGG - Intergenic
1198394829 X:136210145-136210167 CTGTAAAATGGGAGAAAAGACGG - Exonic
1198614601 X:138442567-138442589 CTGTAAGAGATGCTGGAAGAGGG - Intergenic
1198779361 X:140217676-140217698 TTGTAAAAGAGGAGCAAAGTTGG - Intergenic
1200174438 X:154103054-154103076 GTTTAAAAGAGAATGGAAGAAGG - Intergenic
1200268106 X:154657194-154657216 CTGCAAAAGAAGAGGAAATATGG - Intergenic
1200450500 Y:3321713-3321735 TTCTAAAAGAGGAGGGCATATGG - Intergenic
1200773022 Y:7144739-7144761 GTGAAAAAGAAAAGGGAAGATGG - Intergenic
1201953275 Y:19589184-19589206 ATGTAAAAGGGCAGGGAATAAGG - Intergenic