ID: 901564985

View in Genome Browser
Species Human (GRCh38)
Location 1:10106558-10106580
Sequence GGAGAGATCCTCAGGGAGGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 451
Summary {0: 1, 1: 0, 2: 2, 3: 38, 4: 410}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901564985_901564998 30 Left 901564985 1:10106558-10106580 CCCTCCTCCCTGAGGATCTCTCC 0: 1
1: 0
2: 2
3: 38
4: 410
Right 901564998 1:10106611-10106633 TGTGTTTGCGGTGCAGGGAAAGG 0: 1
1: 0
2: 1
3: 23
4: 266
901564985_901564996 24 Left 901564985 1:10106558-10106580 CCCTCCTCCCTGAGGATCTCTCC 0: 1
1: 0
2: 2
3: 38
4: 410
Right 901564996 1:10106605-10106627 TGCATGTGTGTTTGCGGTGCAGG 0: 1
1: 0
2: 2
3: 38
4: 345
901564985_901564997 25 Left 901564985 1:10106558-10106580 CCCTCCTCCCTGAGGATCTCTCC 0: 1
1: 0
2: 2
3: 38
4: 410
Right 901564997 1:10106606-10106628 GCATGTGTGTTTGCGGTGCAGGG 0: 1
1: 0
2: 9
3: 20
4: 235
901564985_901564995 18 Left 901564985 1:10106558-10106580 CCCTCCTCCCTGAGGATCTCTCC 0: 1
1: 0
2: 2
3: 38
4: 410
Right 901564995 1:10106599-10106621 GAGAGTTGCATGTGTGTTTGCGG 0: 1
1: 0
2: 2
3: 22
4: 303
901564985_901564991 -4 Left 901564985 1:10106558-10106580 CCCTCCTCCCTGAGGATCTCTCC 0: 1
1: 0
2: 2
3: 38
4: 410
Right 901564991 1:10106577-10106599 CTCCTAGGTATTTATCCCACAGG 0: 1
1: 1
2: 5
3: 45
4: 237

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901564985 Original CRISPR GGAGAGATCCTCAGGGAGGA GGG (reversed) Exonic
900146278 1:1160241-1160263 GGGGGGATGCGCAGGGAGGAGGG + Intergenic
900161351 1:1225463-1225485 GCAGAGATCCTCATGGAAGAAGG + Intronic
900960345 1:5915111-5915133 AGAGAAGTCCTGAGGGAGGAGGG + Intronic
900990614 1:6096654-6096676 GACAAGATCCTCAGTGAGGAGGG + Exonic
901564985 1:10106558-10106580 GGAGAGATCCTCAGGGAGGAGGG - Exonic
901761597 1:11475292-11475314 GAACAGAGCTTCAGGGAGGAAGG + Intergenic
902396133 1:16133315-16133337 GAAGACATCCTCGGGGAAGAAGG - Exonic
902489009 1:16766898-16766920 TAGGAGGTCCTCAGGGAGGAGGG - Intronic
902619141 1:17640319-17640341 GGAGAGTGCCTCAGGGGGCAGGG + Intronic
902803531 1:18846408-18846430 GGAGAGTTCCACAGGGAACAGGG - Intronic
903478679 1:23637835-23637857 GGAGAGCACCTCACGGAGGGGGG - Intronic
904284348 1:29444375-29444397 TGGGAGCTCCTCAGGCAGGATGG + Intergenic
904613730 1:31738844-31738866 GGAGAGCTCCACAGTGATGAGGG + Exonic
904874977 1:33647255-33647277 GGTGCCATTCTCAGGGAGGAAGG + Intronic
904986033 1:34549609-34549631 TGAGAGGTGCTCAGGTAGGATGG - Intergenic
905388721 1:37622692-37622714 GGAGAGATCTTCAGGGACCAGGG + Intronic
905865266 1:41373042-41373064 GGAGAAAGCAGCAGGGAGGAGGG + Intronic
905867342 1:41383178-41383200 GGAGGGCTGCTCAGGGTGGATGG - Exonic
907233794 1:53025988-53026010 GCAAAGATCCTGAGGGAGAAAGG - Intronic
907978702 1:59459695-59459717 GAAGAGATCAGCAGGGAGAAAGG + Intronic
908437770 1:64123087-64123109 GGAGAGATACTGAGGAAGGAAGG - Intronic
908605597 1:65793518-65793540 GGAGAGAGGCTAAGGGAGAATGG + Intronic
908850755 1:68373463-68373485 GGAGAAACCGGCAGGGAGGAGGG - Intergenic
909021172 1:70432977-70432999 GGAGAGAACCTCAGGGGGCTGGG - Intronic
909164120 1:72195967-72195989 TGAGTGAACCTGAGGGAGGAAGG - Intronic
910017594 1:82546745-82546767 GGAAAGCTGCTCAGGGAGTATGG + Intergenic
910721430 1:90290570-90290592 GGGGAGAGCAGCAGGGAGGAGGG + Intergenic
910727675 1:90355878-90355900 GGAGAGAAACTGAGGAAGGAAGG + Intergenic
912499084 1:110110060-110110082 GGAGACATTTTCAGGGAAGAAGG + Intergenic
912509220 1:110176870-110176892 GGAGAGATGCACAGGGAAGGGGG + Intronic
912848925 1:113104330-113104352 TGAGAGATCCCCAGGAAGGGTGG - Intronic
912945536 1:114081152-114081174 GGAGAGAACCTCCAGGAGGGAGG + Intergenic
912961244 1:114197543-114197565 GGAGAGGTGCTTAGGAAGGAAGG + Intergenic
913088061 1:115457400-115457422 GGTGAGTTCCTCAGGGAAGGTGG - Intergenic
913149586 1:116027480-116027502 GGAGAAATCCTTAGGGTGCACGG + Intronic
913270091 1:117084670-117084692 AGAGGGATGCTCAGGAAGGAGGG + Intronic
913664779 1:121037305-121037327 GGAGGCATCCCCAGGGATGATGG - Intergenic
914016171 1:143820580-143820602 GGAGGCATCCCCAGGGATGATGG - Intergenic
914161611 1:145140428-145140450 GGAGGCATCCCCAGGGATGATGG + Intergenic
914442858 1:147722332-147722354 GGCGATGTCCTTAGGGAGGAGGG + Intergenic
914492346 1:148160317-148160339 ACAGAGATCCTGAGGTAGGAGGG - Intergenic
916907207 1:169299578-169299600 GAAGAGATCCTCCTGGAGAAAGG + Intronic
917274046 1:173311728-173311750 GGAGAGATGCTGGAGGAGGAAGG - Intergenic
917668199 1:177246181-177246203 GGAGAGATCCCCAGGCAGGAAGG - Intronic
917804811 1:178604121-178604143 AGAGAGAGTCCCAGGGAGGAGGG - Intergenic
919031911 1:192252439-192252461 GGAGTGATCCACAGAGAGGAAGG - Intergenic
919860627 1:201737533-201737555 GGTGAGACACACAGGGAGGAGGG + Intronic
920195182 1:204222005-204222027 AGAGAGATCCTCAGAGTGGAAGG - Exonic
922078254 1:222268983-222269005 GGAGAGATATCCAGAGAGGAGGG - Intergenic
922707223 1:227795833-227795855 GGGGAGCTCCTGAGGAAGGAGGG - Intergenic
923531427 1:234815626-234815648 TAGGAGGTCCTCAGGGAGGAGGG + Intergenic
923959132 1:239057078-239057100 GGAGGGAACCCCAGGGAGGGAGG + Intergenic
1064065823 10:12180720-12180742 GGGAAGAGCCTCAGGGAGGCTGG - Intronic
1067937218 10:50623109-50623131 GGAGCGCTCCTCGGGGAGGGGGG + Intronic
1068378318 10:56213469-56213491 GGAGAGACCAGCAGGCAGGAGGG + Intergenic
1070484452 10:76915971-76915993 GGAGAAATCCTGAGGTGGGATGG - Intronic
1070728860 10:78811101-78811123 GGAGAGAGCGGCAGGGAGAAAGG + Intergenic
1070774888 10:79103711-79103733 GCAAAGAGCCCCAGGGAGGAGGG - Intronic
1073669400 10:105570798-105570820 GGAGGGACCCTATGGGAGGATGG - Intergenic
1074881825 10:117665551-117665573 AGAGAGAGCCTTAGGGAAGATGG + Intergenic
1075271384 10:121054644-121054666 GGAGAGATGCTGCAGGAGGAGGG - Intergenic
1075595549 10:123726626-123726648 GGAGAGATGGACAGGGAAGATGG + Intronic
1075654366 10:124151649-124151671 GGACAGAGGCTCAGGGAGGCTGG + Intergenic
1076191983 10:128489534-128489556 AGAAAGCTCCCCAGGGAGGAGGG - Intergenic
1076790542 10:132774847-132774869 GGAGAGACGGGCAGGGAGGAGGG + Intronic
1076790573 10:132774934-132774956 GGAGAGACGGGCAGGGAGGAGGG + Intronic
1076790584 10:132774964-132774986 GGAGAGAGGGACAGGGAGGAGGG + Intronic
1076790637 10:132775094-132775116 GGAGAGACAGGCAGGGAGGAGGG + Intronic
1077403245 11:2369240-2369262 GGAGGGGACCCCAGGGAGGAGGG - Intergenic
1078692314 11:13594569-13594591 GGAGAGATCCTCAGTGAACAAGG + Intergenic
1079631602 11:22684295-22684317 GGAGAATGCCTCAGTGAGGACGG + Intronic
1081814245 11:45929661-45929683 GGTGGGGTCCTCAGGGAGGAAGG + Intronic
1082877494 11:58002928-58002950 GCAGAGATATTCTGGGAGGATGG + Intergenic
1082894625 11:58176867-58176889 GGAGAAATCCTAAGGGTGTAGGG - Intronic
1083878926 11:65538850-65538872 GGAAACACCCTCTGGGAGGAAGG + Exonic
1085245346 11:75096751-75096773 GGAGATAGGCTCAGGGAGGTTGG - Intergenic
1087908883 11:103729876-103729898 GGAGAGAGACAGAGGGAGGAAGG + Intergenic
1088457851 11:110050911-110050933 GGAGAGATAGAGAGGGAGGAGGG - Intergenic
1089497914 11:118916983-118917005 GCAAACAGCCTCAGGGAGGAGGG + Intronic
1091212130 11:133871139-133871161 GGAAAGATCCTCATGAAGGTGGG + Intergenic
1091448440 12:558168-558190 GGTGAGCCCCTCAGGGAGGACGG + Intronic
1091486532 12:894405-894427 GGACAGAGCCTCATGGAGGGAGG + Intronic
1092313730 12:7387653-7387675 GGTGAGGTCCTCAGGTAGCATGG - Intronic
1094435602 12:30417816-30417838 AGCTAAATCCTCAGGGAGGATGG - Intergenic
1094660611 12:32466961-32466983 GGAGAGAAGCTCTGGGAGTAGGG - Intronic
1095949505 12:47773993-47774015 GCTGAGACCCACAGGGAGGACGG + Intronic
1096080433 12:48829009-48829031 GGACAGATCCTCTGAGAGAAGGG - Intergenic
1096778912 12:53980909-53980931 GGAGAGAAGCTTTGGGAGGAGGG - Intergenic
1097037695 12:56134548-56134570 GGAGAGATATTCAGGGAGGTGGG - Intronic
1097275122 12:57807838-57807860 GGAGAGAACCAGAGGGAGAAAGG - Intronic
1098337864 12:69422139-69422161 TGTGAGATCCTTAGGGAGAAGGG + Intergenic
1098592059 12:72225868-72225890 GGTGAGTTCCTCAGAGAAGAAGG + Intronic
1099473186 12:83075383-83075405 CAAGAGATCATCATGGAGGATGG - Intronic
1100028024 12:90153019-90153041 GGCGTGATCCACAGAGAGGAAGG + Intergenic
1101153647 12:101907305-101907327 GTAGAGATTATCAGGGAGCAGGG + Intronic
1101640514 12:106583237-106583259 CTAGAGATGCCCAGGGAGGAAGG - Intronic
1102260999 12:111443196-111443218 AGAGGGATCCTCAGGTAGGCGGG + Intronic
1102784474 12:115593044-115593066 GGAGAGATACACGTGGAGGAAGG - Intergenic
1103152505 12:118653005-118653027 GGGGACATCCTCAGTGGGGAAGG + Intergenic
1103211209 12:119167881-119167903 GAAGAGATCCTTATGGAGGGTGG - Intergenic
1103402110 12:120650176-120650198 GGAGATGGCCTCAGGGAGGGGGG - Intronic
1104133665 12:125917737-125917759 GAAGATGTCCTGAGGGAGGAGGG + Intergenic
1104386431 12:128355261-128355283 GGAGGGATCTTCAGGAGGGAAGG + Intronic
1104519400 12:129459091-129459113 ACAGAGACCTTCAGGGAGGAGGG - Intronic
1104550121 12:129749030-129749052 GGAGAGATCAGCAGAGAAGAAGG + Intronic
1104755780 12:131268591-131268613 GGAGAGAGCCTGAGAGAGGATGG - Intergenic
1104777927 12:131402090-131402112 GGAGAGAGCCTGAGAGAGGATGG + Intergenic
1104890922 12:132139772-132139794 GGAGAGAAGCTCATGGTGGAAGG + Intronic
1105892061 13:24689020-24689042 GGAGGGATCTCCAGGCAGGATGG + Intronic
1107320091 13:39177416-39177438 GGAGTGATCCTGAGGGAGTAGGG + Intergenic
1107958310 13:45538757-45538779 TGGGAGAGCCTCAGGGAGAAGGG + Intronic
1110790598 13:79582457-79582479 GGCATGATCCACAGGGAGGAAGG - Intergenic
1113369197 13:109707218-109707240 GGAGAAATTCACAGAGAGGAGGG + Intergenic
1113881261 13:113627935-113627957 GGGGAGCTCCTGGGGGAGGAGGG + Intronic
1114260106 14:21030433-21030455 GGAGAGAGCAACAGGGAAGAGGG + Intronic
1114479802 14:23025662-23025684 GGAGAGAGAGGCAGGGAGGAGGG - Intronic
1115356038 14:32448814-32448836 GGAAAGATCCTGAGAGAGTAAGG + Intronic
1115426380 14:33264844-33264866 GGAGAGTTCCTCAGAGACCAGGG + Intronic
1116171423 14:41407469-41407491 TTACAGATCCTCAGGAAGGAGGG + Intergenic
1117254507 14:53964074-53964096 GGAGAGAACGTCAGGGAGCAGGG - Intergenic
1117314685 14:54562699-54562721 GGAGAGATCAGAAGTGAGGAAGG + Intergenic
1117902052 14:60544482-60544504 GGAGACATCTTTAGAGAGGAGGG - Intergenic
1118715419 14:68556404-68556426 GGAGCGATCTGCAGGGAGGAAGG - Intronic
1118893121 14:69925215-69925237 GGAGGGATGCTAAGGGAGGAGGG + Intronic
1119207833 14:72808015-72808037 GGGGTGACCCTCAGGGAGGGAGG - Intronic
1120791524 14:88588166-88588188 GGAGAGAGGCTCCAGGAGGAAGG - Intronic
1121253445 14:92515326-92515348 GAGGAGTTTCTCAGGGAGGAAGG + Intronic
1121456333 14:94041061-94041083 GGAGAGATCCAGAGGGGAGATGG + Intronic
1121619522 14:95336628-95336650 GCAGAGACCAGCAGGGAGGAGGG - Intergenic
1123065312 14:105616158-105616180 GGAGGGATCCACAGAGAAGACGG + Intergenic
1123069511 14:105635594-105635616 GGAGGGATCCACAGAGAAGACGG + Intergenic
1123094556 14:105760752-105760774 GGAGGGATCCACAGAGAAGACGG + Intergenic
1128501238 15:68229148-68229170 GGAGAGCTCCCCAGGGCGGTGGG - Intronic
1128549725 15:68590435-68590457 GGAGACAGCCTCCGAGAGGATGG + Intronic
1128799790 15:70490169-70490191 GCATAGAGGCTCAGGGAGGAGGG - Intergenic
1129754967 15:78092616-78092638 GGAGAGATCCTGAGGGGGCAGGG + Exonic
1129905446 15:79184006-79184028 GGAGAGACCCCCAGCCAGGAGGG - Intergenic
1131017011 15:89066365-89066387 GGAGAGATACACAGGGAAGAGGG - Intergenic
1131074932 15:89489585-89489607 GTAGAGATCCCCTGGGAGGCAGG - Intronic
1131460909 15:92616917-92616939 GAGTAGCTCCTCAGGGAGGAGGG + Intergenic
1131943451 15:97592975-97592997 AGTGAGGTCATCAGGGAGGAAGG + Intergenic
1132346911 15:101114098-101114120 GGTGAGATGCTCGGGGAAGAGGG - Intergenic
1132382829 15:101378685-101378707 GTAGAGAACATCAGGGAAGAGGG - Intronic
1132535131 16:475150-475172 GGAGAGAGGCTCAGGGAAGAAGG + Intronic
1133306590 16:4813398-4813420 GGCCAGATGCTCGGGGAGGAGGG + Intronic
1133717868 16:8466778-8466800 GGAGAGAGAGGCAGGGAGGAAGG + Intergenic
1134054771 16:11162990-11163012 GGAGAGGATCTCAGGGAGGCCGG + Intronic
1134682567 16:16136631-16136653 GGGGAGAACCTCAGGTAGGCGGG + Exonic
1135732531 16:24906926-24906948 AGGCAGAACCTCAGGGAGGACGG - Intronic
1135912931 16:26577943-26577965 GGAAAGATGCTCAGGGATGAAGG - Intergenic
1136630244 16:31485670-31485692 GGTCAGATCCTCAGGGATGAGGG + Intronic
1137935217 16:52628624-52628646 AGAGAGATCCTCAGGAAGCAGGG + Intergenic
1138105326 16:54284721-54284743 GGAGAGAGCTGCAGGGCGGAAGG + Exonic
1138449886 16:57087467-57087489 AGAGAGACCCTCAGGAAGGCAGG + Intergenic
1140087351 16:71808876-71808898 GGAGGGATCCTGAGGAAGGAGGG + Exonic
1140229191 16:73103426-73103448 GGAGAGACCCTCCAGGAGGAGGG - Intergenic
1140580292 16:76223543-76223565 GGAGAGAGGCCCTGGGAGGAGGG - Intergenic
1140702830 16:77598316-77598338 GAAGAGAGGTTCAGGGAGGAAGG + Intergenic
1140722836 16:77786984-77787006 GGAGAAGTTCTCATGGAGGAGGG - Intergenic
1140904059 16:79395458-79395480 GGTGAGATCATAATGGAGGAGGG + Intergenic
1141115449 16:81304814-81304836 GGAGAGAAGTTCAGGCAGGAGGG + Intergenic
1141438240 16:84013118-84013140 GGAGAGGTCCTCAGGGACCCAGG + Intronic
1141862477 16:86727479-86727501 GGAGAGATGGGCAGGAAGGACGG + Intergenic
1142119395 16:88378497-88378519 GGAGCCGTCCTCAGGGAGGTGGG + Intergenic
1142133354 16:88441001-88441023 GGGGAGGTCCTCAGTGAGGATGG - Intergenic
1142170070 16:88617164-88617186 AGAGAGAACCTCAGGAAAGAGGG - Intronic
1142343829 16:89541450-89541472 GGGGAGGTCTCCAGGGAGGAGGG + Intronic
1143393658 17:6575521-6575543 GGAGAGATCCCCAGTCGGGAGGG + Intergenic
1143765817 17:9137120-9137142 AGAGAGGTCTTCATGGAGGAGGG - Intronic
1144245925 17:13364530-13364552 AGAGACATGGTCAGGGAGGAGGG + Intergenic
1145843026 17:28012277-28012299 GGAGAGAAACTGAGGGAGAAAGG + Intergenic
1148559139 17:48596169-48596191 GGCGAGTTCCTCGGGAAGGAAGG + Exonic
1148809897 17:50283724-50283746 GGAGAGTTTCTAAAGGAGGAAGG - Intergenic
1150295163 17:64003485-64003507 GGAAAGAACTTCAGGGAAGAGGG + Intronic
1151329525 17:73398609-73398631 TGAGAGATTCTAAGGCAGGAGGG - Intronic
1151560840 17:74868778-74868800 GGTTAAATCCTCAGGGAGGAGGG - Intronic
1151703681 17:75756043-75756065 GGAGAGAGGCCCAGGGAGGTGGG - Intronic
1152480047 17:80544994-80545016 GGAGAGAGCCTCGGGGCTGAAGG + Intronic
1153707989 18:7766706-7766728 GGAGAGATCCTGCAGGAGGAAGG - Intronic
1154141370 18:11827052-11827074 GGAGAGACCCGGAAGGAGGAGGG + Intronic
1155109784 18:22702812-22702834 GGAAAGAATCTCAGGGGGGAGGG - Intergenic
1155117484 18:22783899-22783921 GGACAGAGCCCCAGGGAGGAGGG - Intergenic
1157750120 18:50170991-50171013 AGAGAGAGCCTCAGGGAGGCAGG - Intronic
1159904550 18:74077959-74077981 GGTTAGATCCTATGGGAGGAAGG + Intronic
1160231664 18:77053733-77053755 GGAGAGAGCAGCAGGGACGAGGG + Intronic
1160521797 18:79512108-79512130 GGAGCCGGCCTCAGGGAGGATGG + Intronic
1160576448 18:79857006-79857028 GGAGAGCTCCTCTGGGACGGAGG - Intergenic
1161278691 19:3433633-3433655 GGAGGGGGCCGCAGGGAGGAAGG + Intronic
1161461416 19:4400097-4400119 GGACAGAGCCCCTGGGAGGAGGG - Intronic
1161717780 19:5886526-5886548 AAAGAGATACACAGGGAGGAAGG + Intronic
1162032887 19:7925042-7925064 GGTGAGATGCGCAGAGAGGAAGG + Exonic
1162147223 19:8620361-8620383 GGAGAAAACCTCAGGCAGGCTGG + Intergenic
1162158623 19:8696396-8696418 GGAGAGTTCTGCAGGGATGATGG + Intergenic
1164437935 19:28248296-28248318 GGAGAGATGGGCAGGGAGGGTGG - Intergenic
1165404780 19:35622896-35622918 GCAGAGCTCCTCAGAGAGGGCGG - Exonic
1165592989 19:36987194-36987216 GGAGAGAATGTCAGGCAGGAAGG + Intronic
1165932429 19:39368454-39368476 GGAGAGAACCCCAAGGAAGATGG + Intronic
1165950070 19:39469336-39469358 GGCAAGATCCTCAGCGTGGATGG + Exonic
1166218908 19:41353165-41353187 GCTGAGGTCCTCAGGGAGAAGGG + Exonic
1166976732 19:46609326-46609348 GGAGAGAGACTCAGGGAAGAAGG - Exonic
1167247671 19:48383422-48383444 GGGCAGATCCACAGGGAGGGAGG + Intronic
1167552320 19:50169697-50169719 GGATAGAGACTCAGAGAGGAAGG - Intergenic
1168348011 19:55660241-55660263 GGAGTGGACATCAGGGAGGAAGG - Intronic
925818448 2:7776179-7776201 GGAAAGTTCCTCAGAGAGCAAGG - Intergenic
926048529 2:9728022-9728044 GCAGAGAGCCCCAGTGAGGAAGG + Intergenic
927252980 2:21015175-21015197 GGAGAGATCCACAGGGAAATTGG + Exonic
927939958 2:27097389-27097411 GGAGAGGGCCTCGGGGAGGCTGG - Intronic
928410831 2:31052623-31052645 GGACATATCCTCAGGGAGGTGGG + Intronic
928923796 2:36555291-36555313 GGACAGATCATTAGTGAGGACGG - Intronic
931451388 2:62370191-62370213 GCAGAAATCCTGAGGCAGGAGGG + Intergenic
932125750 2:69144271-69144293 GGAGAGACCCTGAGGGCAGAGGG - Intronic
932179038 2:69629113-69629135 GGAGAGAACCTCAAAGAAGATGG - Intronic
932319623 2:70812199-70812221 AGAGACATCAGCAGGGAGGAAGG - Intronic
933602622 2:84348265-84348287 GGCGTGATCCACAGAGAGGAAGG - Intergenic
933669057 2:84989525-84989547 GGATGGATCTGCAGGGAGGAAGG + Intronic
933719783 2:85390601-85390623 GGAGAGATCACCAGAGAGGTAGG - Exonic
934117444 2:88810810-88810832 GAAAAGACCCTCAGGGAAGAAGG - Intergenic
934219763 2:90071853-90071875 AGAAAGGTCCTCACGGAGGATGG - Intergenic
934578490 2:95418600-95418622 GTAGAGAGCTTCAGGAAGGAGGG + Intergenic
934600954 2:95658113-95658135 GTAGAGAGCTTCAGGAAGGAGGG - Intergenic
934650987 2:96091327-96091349 GGAGAGAGCGTCGGGGAGGCAGG + Intergenic
934686509 2:96325591-96325613 GGAGACATCCCGAGGTAGGATGG + Intronic
936241541 2:110792236-110792258 GGACAGATTCTAGGGGAGGAGGG + Intronic
936243169 2:110805660-110805682 GGAGAGATGACCAGGGAGAACGG + Intronic
936534326 2:113300262-113300284 GTAGAGAGCTTCAGGAAGGAGGG - Intergenic
937249615 2:120515232-120515254 GGAGGGAGAGTCAGGGAGGAGGG - Intergenic
937249620 2:120515249-120515271 GGAGGGAGAGTCAGGGAGGAGGG - Intergenic
937249625 2:120515266-120515288 GGAGGGAGAATCAGGGAGGAGGG - Intergenic
937249687 2:120515539-120515561 GGAGAGAGAGTCAGGGAGGAGGG - Intergenic
937249699 2:120515590-120515612 GGAGGGAGAATCAGGGAGGAGGG - Intergenic
937249709 2:120515624-120515646 GGAGGGAGAGTCAGGGAGGAGGG - Intergenic
940735228 2:157443690-157443712 GGTGAGATGCTCAGGGAGCTAGG - Intronic
940852604 2:158702835-158702857 AGAGAGGTTCACAGGGAGGAAGG - Intergenic
940885300 2:158984709-158984731 GGGGAAAGCTTCAGGGAGGAGGG + Intronic
941695809 2:168550132-168550154 AGAGAGAGACTGAGGGAGGAAGG - Intronic
941717679 2:168780759-168780781 GAGGAGATCCTTAGGTAGGAAGG + Intergenic
942901518 2:181125594-181125616 GGAGAGATACTCAGCGAGACTGG - Intergenic
943792095 2:191944883-191944905 GGAGACATCCATAGAGAGGAAGG + Intergenic
944651018 2:201830337-201830359 AGAGAGTGCCTCAGGAAGGAAGG + Intronic
944869664 2:203897198-203897220 GGATAAATTCTCAGGTAGGATGG + Intergenic
946313332 2:218894922-218894944 GAACAGACCCTCAAGGAGGAGGG + Intronic
946365005 2:219243635-219243657 GGAGGGAACCTCAGCGAGCAAGG + Exonic
947909053 2:233789772-233789794 GGAGAGAGCCTGGGGTAGGAAGG + Intronic
947967410 2:234292907-234292929 TGAAAGATCATCAGTGAGGAAGG + Intergenic
948163831 2:235845776-235845798 GGACAGATGCTCAGGAAGAAAGG - Intronic
948577817 2:238965540-238965562 AGTGAGATCGGCAGGGAGGAAGG - Intergenic
1168771398 20:419218-419240 GGAGGTACCCCCAGGGAGGAGGG + Intronic
1169267794 20:4177257-4177279 GGAAAGACCCTCTTGGAGGAAGG + Intronic
1169422332 20:5470667-5470689 GGTGAGGTTGTCAGGGAGGAGGG - Intergenic
1169817391 20:9672054-9672076 AGAGAGATAATCAGCGAGGAAGG + Intronic
1169914134 20:10671103-10671125 AGACAGATCCTCCGGCAGGAGGG + Intronic
1170802893 20:19604790-19604812 GCAGAGCTCCTGAGAGAGGAGGG - Intronic
1170917223 20:20638971-20638993 GGAGAGAATCTCATGAAGGAGGG + Intronic
1172406594 20:34694372-34694394 GAAGAGATCCTGAGGCAGAAAGG + Intergenic
1173017617 20:39239786-39239808 TGAGAGAAACTCAGAGAGGAAGG + Intergenic
1173174814 20:40756478-40756500 GGGGAGAGCCTAAGGGAGAATGG + Intergenic
1173226636 20:41166083-41166105 GGAGGGAGCCTCAAGGAGGGAGG - Intronic
1173273892 20:41561529-41561551 GGAGTGAGTCTCTGGGAGGATGG - Intronic
1173436047 20:43033250-43033272 GGAGAGAGACCCAGAGAGGAAGG - Intronic
1173950056 20:46985196-46985218 GGAGAGAGAGACAGGGAGGAAGG - Intronic
1174128580 20:48326406-48326428 GGAGAGCTCCGCAGGGTGGACGG - Intergenic
1174268648 20:49350693-49350715 GAACTGATCCTCAGGGAGGGAGG + Intergenic
1174467686 20:50730634-50730656 CTAGAAATCCTCAGGGAGGCTGG + Intergenic
1174790389 20:53472627-53472649 AAAGAGCTCCTCAGGGGGGAGGG + Intronic
1175136627 20:56829163-56829185 GAAGAGCTTCTCAAGGAGGAGGG - Intergenic
1175457386 20:59125667-59125689 GGGGAAAAGCTCAGGGAGGAAGG + Intergenic
1175597501 20:60247017-60247039 GGAGTGAGGCTAAGGGAGGAAGG + Intergenic
1175733063 20:61367116-61367138 GTGCAGGTCCTCAGGGAGGAGGG + Intronic
1176083051 20:63283560-63283582 GGAGACTCCCTCAGAGAGGAAGG - Intronic
1176197340 20:63843602-63843624 TGTGGGATCCTCAGGCAGGAGGG - Intergenic
1176244169 20:64089526-64089548 GGAGAGATCAAGAGAGAGGATGG - Intronic
1179416016 21:41199333-41199355 GGAGGGAGCCCCAGGGAGGAGGG + Intronic
1179885342 21:44311927-44311949 GGAGAGAGGCCCAGGGAGGTAGG + Intronic
1180065570 21:45410463-45410485 GGCCAGAGCCACAGGGAGGAAGG + Intronic
1180127571 21:45802690-45802712 GGAGAGGCCCTGAGGGAGGCAGG + Intronic
1180572787 22:16744227-16744249 GGATAGATGCTCAGTGTGGATGG - Intergenic
1180907655 22:19426166-19426188 GGTGAGATGCTCAGGGAGACAGG - Intronic
1182579844 22:31300270-31300292 GGAGAGTGTTTCAGGGAGGAGGG + Intergenic
1183218395 22:36496129-36496151 GGAGACACTCACAGGGAGGAAGG - Exonic
1183232337 22:36590831-36590853 GCAGAGATGCACAGGGAGGGAGG - Intronic
1183372571 22:37442365-37442387 GGAGAGCGCTTCAAGGAGGAGGG - Intergenic
1183725456 22:39586757-39586779 GGACAGGTCCCCAGGGAGGCTGG + Intronic
1183758136 22:39790004-39790026 GCAGAGACCCACAGGCAGGAGGG + Intronic
1184392285 22:44211260-44211282 AGAGTGACCCTTAGGGAGGAGGG - Intronic
1184739579 22:46419608-46419630 GGAGAAAACTTCAGGAAGGATGG + Intronic
1184821402 22:46911441-46911463 GGAGACTTCCTCAGGGAGGGAGG - Intronic
1184959330 22:47917773-47917795 GGAGAGGGACTTAGGGAGGAAGG - Intergenic
1185115052 22:48929242-48929264 GGAGAACGCCTCAGGCAGGAGGG - Intergenic
1185156259 22:49195217-49195239 GGAGGGAACCTCAGGAAGGCTGG - Intergenic
949617053 3:5765371-5765393 AGAAAGTTTCTCAGGGAGGATGG - Intergenic
950480182 3:13239055-13239077 GGGGAGATTCACAGGGAGCAGGG - Intergenic
950893412 3:16425839-16425861 GGACAGCTCCTCAGGGGGTACGG + Intronic
951850795 3:27138040-27138062 GGAGGGATGCTGAAGGAGGATGG + Intronic
953046050 3:39294906-39294928 GCAGAGATCCTCCTGGGGGAAGG + Intergenic
954327978 3:49873926-49873948 GGCCAGATCCCCAGTGAGGATGG + Intergenic
954420442 3:50416306-50416328 GGAGAGATTCCCAGGAAGAAAGG + Intronic
955053181 3:55431943-55431965 GGGAAGATCCTGGGGGAGGAGGG + Intergenic
956695626 3:71916848-71916870 GGAGACACACTCAGAGAGGATGG - Intergenic
957104907 3:75874688-75874710 GGATAGATGCTCAGTGTGGATGG + Intergenic
957149572 3:76468674-76468696 GAAGAGGTTTTCAGGGAGGAGGG - Intronic
958482023 3:94654643-94654665 GGAGTGATCCACAGAGAGCAAGG - Intergenic
959627002 3:108463850-108463872 GGAGAGAGCAACAGAGAGGAAGG + Intronic
961073988 3:123964399-123964421 GGAGAGATCCACATTTAGGAAGG + Intergenic
961081457 3:124032670-124032692 AGAGAGCTCGTCAGGAAGGAGGG + Intergenic
961633386 3:128317847-128317869 GGAGGAAACCTCAGAGAGGAGGG - Intronic
961861896 3:129923338-129923360 GGAGAAATCTTCATGAAGGAAGG - Intergenic
962923863 3:139974346-139974368 AGAGAGATTCTTATGGAGGAAGG - Intronic
964659549 3:159105322-159105344 GTAGATATCCACAGGTAGGAGGG - Intronic
966743019 3:183251424-183251446 GGAGAGATGATCAGAGAGTAAGG - Intronic
966932565 3:184685374-184685396 GGAGAGAGCCTCAGAGAAAAGGG - Intergenic
967345572 3:188451801-188451823 GCAGAGATCCACAGGCAAGAGGG + Intronic
967393107 3:188976604-188976626 AGATAGTGCCTCAGGGAGGAAGG - Intronic
969035975 4:4254311-4254333 GGTGAGTTCCACAGGGATGACGG - Intergenic
969652584 4:8476662-8476684 GGAGAGGGTCTCATGGAGGAGGG - Intronic
970079426 4:12263941-12263963 GGTGAGATCAGCAGAGAGGAGGG + Intergenic
970379464 4:15492615-15492637 GGGGAGATTCTCAGTGAGGTGGG + Intronic
970392347 4:15626468-15626490 GGAGATATACTCTGGGAAGAAGG + Intronic
970668481 4:18366599-18366621 GCAGAGATCCTGATGCAGGAGGG + Intergenic
970968170 4:21950763-21950785 GGAGAGAGAGTCAGAGAGGATGG + Intergenic
972314761 4:37915819-37915841 GGAAAGAAGCTCAGGAAGGATGG - Intronic
972344464 4:38181347-38181369 GGAGAGCTCATTTGGGAGGATGG + Intergenic
973584557 4:52377388-52377410 GGAGTGATCCACGGAGAGGAAGG + Intergenic
978940974 4:114435357-114435379 GGAGAGTTGCTTAGGGAGGTGGG - Intergenic
979412272 4:120393811-120393833 GGACTGAGCCTCAGGGAGGGTGG - Intergenic
981186940 4:141815550-141815572 GGTGTGATCCACAGAGAGGAAGG + Intergenic
981401117 4:144314476-144314498 AGAGAGATCATCATGGTGGATGG - Intergenic
981918503 4:150061076-150061098 GTAGAAATCCTTAGAGAGGAAGG + Intergenic
984115529 4:175675976-175675998 GGAGAGACCCACCGGGAGGTAGG + Intronic
984206557 4:176793079-176793101 GGAGAGATCCAGAGGGGGGCCGG - Intergenic
985706009 5:1401785-1401807 AGAGAGCTCCTCTGGGAGGCTGG - Intronic
985836501 5:2275977-2275999 GGAGAGAGGCTTAGGGTGGAAGG + Intergenic
986690285 5:10308032-10308054 GGAGGGAACCGCAGAGAGGAAGG + Intergenic
987123316 5:14788263-14788285 GGAGGTTTCCTGAGGGAGGAAGG - Intronic
987837375 5:23178972-23178994 GGACAGAACCCCCGGGAGGAGGG - Intergenic
989125274 5:38046764-38046786 GGAGAGATCTTTAAGGAAGATGG - Intergenic
989162689 5:38406926-38406948 GGAGAGATGCTGAGGTAGGGGGG - Exonic
989800845 5:45537027-45537049 GGAGGGATCCTCAGAAGGGATGG - Intronic
990205421 5:53424000-53424022 TCATAGCTCCTCAGGGAGGAGGG - Intergenic
991044846 5:62211714-62211736 GGAGGGATACTGTGGGAGGAAGG - Intergenic
992149895 5:73892471-73892493 GAAGGGGTCCTCATGGAGGAGGG - Intronic
994956878 5:106544353-106544375 TGGGAGATCCAGAGGGAGGACGG - Intergenic
996537543 5:124594109-124594131 AGAGAGATAATCAGGGAAGAAGG + Intergenic
1001225910 5:169944447-169944469 GGAGAGATGCTGAAGGAGGCAGG + Intronic
1001323555 5:170702490-170702512 GCAGAGAGCTTGAGGGAGGAAGG + Intronic
1001329423 5:170751933-170751955 AGAGAGATACTCAAGGAGGAGGG + Intergenic
1001444468 5:171772764-171772786 GGAGAGACCTTTAGGGTGGAGGG - Intergenic
1002571396 5:180141372-180141394 GGAGTCAGCCTCAGAGAGGAAGG + Intronic
1002660952 5:180790954-180790976 GGAGAGAGGTGCAGGGAGGAAGG - Exonic
1003075811 6:2982943-2982965 GGAGAGGCCCCCAGGGAGGTAGG + Intergenic
1003792922 6:9567162-9567184 GGAAAGCTGCCCAGGGAGGATGG + Intergenic
1005170515 6:22980155-22980177 GGCGTGATCCACAGAGAGGAAGG + Intergenic
1005371933 6:25142647-25142669 GAAGAGATCCTCAGGGTGTGAGG - Intergenic
1005976619 6:30804978-30805000 GAAGAGATGCACAGGGAGAAGGG + Intergenic
1006813598 6:36836717-36836739 GGAGAGGAGCACAGGGAGGAGGG - Intronic
1007107832 6:39295623-39295645 GGAGAGAGCATCAGTGAGGCTGG + Intergenic
1007474288 6:42108490-42108512 AGAGACCTCCTCAGTGAGGAAGG + Intronic
1007765847 6:44159313-44159335 GATGAGATCCTCAGGGTGGCAGG + Intronic
1008117503 6:47568959-47568981 GGAGAGTTATTCAGGGAGGCAGG + Intronic
1008527570 6:52421205-52421227 GGAAAGATGCTTTGGGAGGAAGG - Intronic
1011089432 6:83579630-83579652 GGAGAGAGTCCTAGGGAGGAGGG - Intronic
1011715859 6:90104579-90104601 GGAGAGATCATAAGGCAAGATGG - Intronic
1014749294 6:125237025-125237047 GCAGAGACCCTAAGGTAGGAGGG + Intronic
1015751481 6:136564264-136564286 GATGAGATCCTCAGAGAGAAGGG + Intronic
1015783031 6:136891123-136891145 GCAGAGATCCACAGGGATGCTGG - Intronic
1016037493 6:139398003-139398025 GGAGAGATTGTCAGGGACCAGGG - Intergenic
1016989325 6:149918517-149918539 GGAGAGTTCCTGGGGTAGGAAGG + Intronic
1017137456 6:151160964-151160986 TGAGAGATGCCCAGGTAGGAGGG + Intergenic
1017635541 6:156439555-156439577 GGAGAAATACTGTGGGAGGAGGG + Intergenic
1017956584 6:159183328-159183350 GGAGAGATTTTCAGGAAGAAGGG - Intronic
1017999132 6:159563186-159563208 GGAGAGATCCTCCCTGAGGTGGG + Intergenic
1018125508 6:160679039-160679061 GGACTGATCCTCAGGTAGGTGGG - Intergenic
1018308931 6:162488627-162488649 GAAGTGATACTCAGAGAGGACGG - Intronic
1018774695 6:167001981-167002003 GGAGAGATCCTCAAGGTAGTTGG - Intronic
1019006262 6:168799201-168799223 GGAGAGAGCCACAGGCAGGGAGG + Intergenic
1019400481 7:849552-849574 AGAGAGGTTCTCAGAGAGGATGG + Intronic
1019475410 7:1241784-1241806 GGAGAGAGCGGCCGGGAGGAAGG - Intergenic
1019920157 7:4158172-4158194 GTTGAAATCCTCAGGGAGAAAGG - Intronic
1020901203 7:14005531-14005553 ATAGAGATCATCAGGGAGAAGGG - Intergenic
1021239181 7:18179380-18179402 GCTGAGGTCCTAAGGGAGGAGGG + Intronic
1022459927 7:30595212-30595234 GGACAGTTCCCCGGGGAGGAGGG - Intronic
1023360585 7:39411193-39411215 GGATAGTTCGGCAGGGAGGAGGG + Intronic
1023905191 7:44516880-44516902 GAAGAGCCCCTCAGGGAGGATGG + Exonic
1025753656 7:64314106-64314128 TGGGAGATCCATAGGGAGGACGG + Exonic
1026415175 7:70172009-70172031 GGAGAGAAACTCAGGGCAGATGG - Intronic
1026450459 7:70524826-70524848 GGAGAAAGCCTCAAGGAGCAAGG - Intronic
1032089974 7:128906631-128906653 GAAGACTTTCTCAGGGAGGAAGG + Intronic
1032915293 7:136482866-136482888 AGAAAGATCCTCAAGGAGGAAGG - Intergenic
1033445144 7:141414680-141414702 AGAGAGATGCTCAGAGAAGATGG - Intronic
1033663500 7:143420066-143420088 GGCCAGACCTTCAGGGAGGACGG - Intergenic
1034060461 7:148082580-148082602 AGAGAGAGCTTCAGGGAGGTGGG + Intronic
1035188437 7:157143963-157143985 GGAGTGAATCTCAGGGAGGGAGG + Intronic
1035369263 7:158368664-158368686 GGGGGGCTCCCCAGGGAGGAAGG + Intronic
1036147825 8:6270767-6270789 GGCGAGATGACCAGGGAGGAGGG + Intergenic
1039300423 8:36203014-36203036 GGTGAGATGCTCAGGGATGGGGG + Intergenic
1039766354 8:40632505-40632527 GGTGAGATCATCCTGGAGGAGGG + Intronic
1040762959 8:50873656-50873678 GGCGTGATCCACAGAGAGGAAGG + Intergenic
1040932508 8:52749749-52749771 GGAGAGATTATAAGGGATGATGG + Intergenic
1041097259 8:54362051-54362073 GGAGTGAGCCTGAGGGAGGTTGG + Intergenic
1041253765 8:55961028-55961050 GAAGAGACCCTGAGGAAGGAAGG + Intronic
1041318162 8:56585318-56585340 AGAGAGAGCCCCTGGGAGGAAGG + Intergenic
1043990127 8:86742538-86742560 GGAGTGCTCCTCAGGGACTAGGG - Intronic
1045291400 8:100835634-100835656 GGAGGGATGCTGAAGGAGGAAGG - Intergenic
1045506266 8:102780956-102780978 GGAGACAGCCTCAGGGAGGGTGG + Intergenic
1045614681 8:103896021-103896043 GGGGAGATCCTGAGAGAGCACGG - Intronic
1046746746 8:117884000-117884022 GGAGAGAGTCGGAGGGAGGAAGG + Intronic
1047555543 8:125925217-125925239 GGAGAGGGCCACAGAGAGGAAGG - Intergenic
1049231749 8:141488343-141488365 GGAGGGAATGTCAGGGAGGAAGG - Intergenic
1049408129 8:142460709-142460731 GGAGGTACCTTCAGGGAGGAGGG - Intronic
1049510942 8:143026370-143026392 GAACAGATCCGGAGGGAGGAGGG + Intergenic
1049576324 8:143391607-143391629 GGAGAGCCCTTCAGGGAGGTGGG - Intergenic
1049702930 8:144023230-144023252 GAAGAGGTCCTGAGGGAAGAGGG - Intronic
1051275133 9:15391361-15391383 TGAGAGATCCCCAGTGAGGGTGG - Intergenic
1051453431 9:17224010-17224032 GGAGAGATCTAAAGGAAGGAAGG - Intronic
1051857757 9:21588895-21588917 TGAGATAGCCACAGGGAGGATGG + Intergenic
1052176803 9:25472554-25472576 GGAAAGAGCCCTAGGGAGGAGGG - Intergenic
1052183881 9:25565776-25565798 GCTGAGATTCTCAGGTAGGAGGG - Intergenic
1053203699 9:36169283-36169305 GGAGAGATCAGAGGGGAGGAAGG + Intergenic
1054825388 9:69567829-69567851 GCAGAGATGCTCAAGGTGGAGGG - Intronic
1056613572 9:88141707-88141729 GCAGCGATCCTCAGGCAGGCAGG - Intergenic
1056658695 9:88529209-88529231 GGAGAGGGGCTCAGGGAGGGAGG + Intergenic
1056762255 9:89424010-89424032 GGAGAGGTACTGAGGGAGTAGGG - Intronic
1057171153 9:92963975-92963997 GTGTAGATCTTCAGGGAGGAGGG - Intronic
1057714470 9:97480048-97480070 TTAGAGCTCCTGAGGGAGGAAGG + Intronic
1057873307 9:98734029-98734051 TTATAGATCGTCAGGGAGGAGGG - Exonic
1059125202 9:111678188-111678210 GGAGAGATATTCCAGGAGGAAGG + Intergenic
1059262883 9:112995474-112995496 GGAGAGAAAGGCAGGGAGGAAGG - Intergenic
1059958895 9:119545991-119546013 GAAAAGACCCTCAAGGAGGAAGG + Intergenic
1060334038 9:122704865-122704887 TAAGAGATCCTGAGGGAGGGAGG + Intergenic
1060522273 9:124300604-124300626 GGAGAACCACTCAGGGAGGAGGG + Intronic
1061062784 9:128258959-128258981 GGAGAGAGCCCCAGGAAGAAGGG - Intronic
1061098473 9:128473783-128473805 GGAGAAAGGCTCAGAGAGGATGG - Intronic
1061521022 9:131117929-131117951 TCAGAGATCCCAAGGGAGGAAGG - Intronic
1061848438 9:133400953-133400975 GGAGTGACCCTCAGGGAGGATGG + Intronic
1061887871 9:133601878-133601900 GGGAGGAGCCTCAGGGAGGAAGG + Intergenic
1203771510 EBV:52173-52195 GAAGAGCTCCCCAGGGCGGAGGG - Intergenic
1186730364 X:12403247-12403269 GGAGTGATCCCCAAGGAGGCAGG - Intronic
1187867368 X:23736082-23736104 GGCCAGATACTCTGGGAGGAGGG - Intronic
1189236324 X:39489926-39489948 GGAAAGCTGCTCAGGGTGGATGG + Intergenic
1190472723 X:50799033-50799055 GGACAGAGCCTCAGATAGGAAGG - Intronic
1191132581 X:57030644-57030666 GGACAGAGCATCAGGGGGGATGG - Intergenic
1192218086 X:69177809-69177831 GGGGAGACCCTATGGGAGGAGGG - Intergenic
1192588456 X:72339676-72339698 TGAGAGATTGTCAGGGAGCAGGG + Intronic
1194523047 X:94942443-94942465 GGTGTGACCCTCAGAGAGGAAGG + Intergenic
1197214336 X:123854091-123854113 GGAGAGATCATCATCCAGGATGG - Intergenic
1197957783 X:131971533-131971555 GGAGAGAGCTTCAGAGAGGTTGG - Intergenic
1198843086 X:140880176-140880198 GTAGAGATCATCATGGCGGATGG + Intergenic
1199185173 X:144908289-144908311 GGAGAGATCCTGAGTGAAGGTGG + Intergenic
1199853888 X:151744226-151744248 CGGGAGATCCTCATGAAGGAGGG + Exonic
1199938863 X:152604541-152604563 AGAGAGATGGTGAGGGAGGAAGG + Intergenic
1200224279 X:154408689-154408711 GGACAGAGCCTCAGAGAGGTAGG - Intronic
1201979570 Y:19892460-19892482 GGTGTGATCCACAGAGAGGAAGG + Intergenic