ID: 901566251

View in Genome Browser
Species Human (GRCh38)
Location 1:10118258-10118280
Sequence ATTTGTAAAGGGCCTTCTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 222}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901566245_901566251 3 Left 901566245 1:10118232-10118254 CCTCGTTGCCCACTGGTTAGTTT 0: 1
1: 0
2: 0
3: 7
4: 48
Right 901566251 1:10118258-10118280 ATTTGTAAAGGGCCTTCTTTGGG 0: 1
1: 0
2: 0
3: 23
4: 222
901566246_901566251 -5 Left 901566246 1:10118240-10118262 CCCACTGGTTAGTTTCATATTTG 0: 1
1: 0
2: 1
3: 12
4: 171
Right 901566251 1:10118258-10118280 ATTTGTAAAGGGCCTTCTTTGGG 0: 1
1: 0
2: 0
3: 23
4: 222
901566247_901566251 -6 Left 901566247 1:10118241-10118263 CCACTGGTTAGTTTCATATTTGT 0: 1
1: 0
2: 0
3: 30
4: 229
Right 901566251 1:10118258-10118280 ATTTGTAAAGGGCCTTCTTTGGG 0: 1
1: 0
2: 0
3: 23
4: 222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901566251 Original CRISPR ATTTGTAAAGGGCCTTCTTT GGG Intronic
901542552 1:9929054-9929076 ATAGGTATAGGGCCTCCTTTGGG + Exonic
901566251 1:10118258-10118280 ATTTGTAAAGGGCCTTCTTTGGG + Intronic
902886093 1:19405963-19405985 ATTTGCAAAGGGACTCATTTTGG + Intronic
902998840 1:20249838-20249860 ATTTGTACAGGGACTTTTTTGGG - Intergenic
903125087 1:21242364-21242386 TTTTGTGAATGGCCTTCATTCGG - Intronic
906165009 1:43679585-43679607 CTATGTCAAGGGCCTTTTTTAGG + Intronic
906256689 1:44355789-44355811 ATTTGTGAAGGGCCGTCCTAAGG + Intergenic
906419445 1:45651916-45651938 GTTTGTAAAAGACCTTGTTTTGG - Intronic
907346286 1:53783776-53783798 ATCTGGTAAGGGCCTTCTTGCGG - Intronic
908426123 1:64009198-64009220 ATTTCCAAAGGGCCTGCCTTTGG - Intronic
909203851 1:72727611-72727633 ATTTGTTAATGCCCGTCTTTTGG - Intergenic
911779372 1:101856726-101856748 ATTTATCAAGTGCATTCTTTGGG + Intronic
912134608 1:106645081-106645103 ATTTTTAAAAGCCCTTCTTTGGG + Intergenic
912577787 1:110690686-110690708 ATTTGTAAACTGATTTCTTTGGG - Intergenic
916447739 1:164889454-164889476 ATTTGTAAAGGGGCTTACTCTGG - Intronic
917624950 1:176836151-176836173 ATTTGGAAAGGAGCTTCTTTGGG + Intronic
917672084 1:177282424-177282446 TTTTGGAAAAGGCCTTTTTTAGG + Intergenic
919268234 1:195302839-195302861 ATTTGTAATGGGCCTTTCTTTGG - Intergenic
919427900 1:197456747-197456769 ATTTATCAAGGGCCTTTTTCAGG - Intronic
921326922 1:213994832-213994854 ATTTTAAAAGAGCCTGCTTTAGG - Intronic
923492487 1:234496307-234496329 TTTTTTAAAGAGCATTCTTTAGG + Intergenic
924401564 1:243688464-243688486 ATTTGCAAAGGAACTTTTTTTGG + Intronic
1062804353 10:406018-406040 ATATGTAAAGAGGCTTATTTTGG - Intronic
1065152881 10:22840328-22840350 ATTTCAAAAGTGGCTTCTTTAGG - Intergenic
1065534550 10:26704414-26704436 ATATGGAAATGGCTTTCTTTGGG + Intronic
1069087552 10:64159012-64159034 ATTACTAAAGGCCCATCTTTAGG + Intergenic
1071118579 10:82251907-82251929 ATTGCTCAGGGGCCTTCTTTTGG - Intronic
1072074222 10:91952640-91952662 ATTTGTAAAGTGTATTTTTTAGG + Intronic
1073657775 10:105435741-105435763 ATCTTTAAAGGGCCTTCTCAAGG - Intergenic
1074398802 10:113124107-113124129 ATTTGGAAAGGCTCTTTTTTTGG + Intronic
1075443055 10:122494583-122494605 ATTTGGAAACGGCCTTGTTGAGG + Intronic
1076283551 10:129272075-129272097 TTTTGAAAAGGGCTTTCTTGAGG - Intergenic
1079701972 11:23559255-23559277 ATTAGTAAAGGGCCATATTCTGG - Intergenic
1080460775 11:32452871-32452893 TGTTGTAAAAGGCATTCTTTGGG + Intergenic
1080678854 11:34454362-34454384 TATTATAAAGGGCCCTCTTTTGG + Intronic
1080909724 11:36583448-36583470 ATTTGTAAGATGCCTTCTATGGG + Intronic
1081336691 11:41875306-41875328 ATTTGTTAAGGTCGTTGTTTTGG - Intergenic
1081554498 11:44145819-44145841 ATTTGTAAAATGCCTACTTTGGG + Intronic
1082604887 11:55214143-55214165 ATCTGCAAAGGGACTTTTTTGGG - Intergenic
1083129396 11:60609988-60610010 ATTTGTAAATAGCTTTGTTTAGG + Intergenic
1084512452 11:69614690-69614712 ATTTGCAAATGGGCTTGTTTTGG - Intergenic
1085135999 11:74088922-74088944 AGTTGTATACAGCCTTCTTTAGG - Intronic
1086360398 11:86052861-86052883 ATTTGTAAATGGGGTGCTTTTGG - Intronic
1086454310 11:86946385-86946407 ATTTGTAGAGGACCTTTTTGGGG - Exonic
1086864777 11:91967309-91967331 ATTTGTAAAGTGCTGACTTTGGG - Intergenic
1087695724 11:101373639-101373661 ATGTCTAAAGTGCGTTCTTTAGG + Intergenic
1087956415 11:104293330-104293352 ATTTTTTAAGGGCTTTCTTTGGG + Intergenic
1089644643 11:119870650-119870672 ATTTGTAAAGGGGTCACTTTGGG - Intergenic
1091614495 12:2039086-2039108 ATTTGCAAAGGGCTGTCTGTTGG - Intronic
1094232988 12:28129247-28129269 ATATGTAAAGGGCTTTCCCTGGG - Intergenic
1094331273 12:29296713-29296735 ATTTATAAAGGTGCTTCTATAGG - Intronic
1099357415 12:81655710-81655732 ATCTGTATATGGCCTTCATTTGG + Intronic
1103273450 12:119692135-119692157 ATTTTTGAAGAGCCTTCTTTAGG - Intronic
1104111978 12:125712561-125712583 ATTTCTAAAGTGGATTCTTTGGG - Intergenic
1104318774 12:127730045-127730067 ATTTGTTATGGGCTGTCTTTTGG - Intergenic
1105911775 13:24875316-24875338 ATTTGTAAACTGCTTTCTTTGGG - Intronic
1106497171 13:30290257-30290279 ATTTGTGAAGAACCTGCTTTTGG - Intronic
1107349201 13:39496496-39496518 GTTTTGAAAGAGCCTTCTTTAGG - Intronic
1107509407 13:41067748-41067770 ATTTGTAAAGGATCTTTGTTAGG + Intronic
1107960508 13:45553805-45553827 AATTTTAAAGGGCTTTTTTTAGG - Intronic
1108675022 13:52729186-52729208 ATTTCTAAAGTGCCCTCTTGGGG - Intronic
1111036929 13:82687367-82687389 ATTTGAAAATGGCCTTGTTGAGG + Intergenic
1111390045 13:87581854-87581876 ATTTATCAAGGGCCTTTTTCAGG + Intergenic
1113504463 13:110805589-110805611 ATTTGTAAAGCACCTTCATATGG + Intergenic
1115349159 14:32374562-32374584 AGTTGTGAAGGGCCTACTTAAGG + Intronic
1116290673 14:43034051-43034073 ATTTGTAAATGATCTTGTTTTGG - Intergenic
1116693932 14:48148721-48148743 ATTTGTTTAGGGCTTTCTCTTGG + Intergenic
1117656999 14:57965508-57965530 ATTTGGACAAGGACTTCTTTGGG + Intronic
1119852506 14:77876040-77876062 ATTTGTAAAGGGCCTGCATGAGG + Intronic
1119917187 14:78413108-78413130 ATTTGTTGAGGGAGTTCTTTTGG + Intronic
1120471345 14:84928813-84928835 ATTAGGAAAGGGACATCTTTGGG + Intergenic
1121356424 14:93219128-93219150 TTTTGTAAAGAGATTTCTTTAGG - Intronic
1121524180 14:94607118-94607140 ATTGGTACAGGCCCTTCCTTCGG - Intronic
1122392569 14:101400153-101400175 ATTTGTTGAGTGCCTTCTTGAGG - Intergenic
1126344647 15:47680044-47680066 CTTTGTAATGGGGCTTCTTGGGG - Intronic
1127572103 15:60253643-60253665 ATTTGGAAAGCGCCTTCTAGAGG - Intergenic
1129479989 15:75816034-75816056 ACTTGCAAAGGGCTTTGTTTGGG + Intergenic
1130158965 15:81379894-81379916 ATTTTTAAAAGGCCTTGCTTTGG - Intergenic
1131962804 15:97807299-97807321 ATTTGCCAAGGGTCTCCTTTGGG + Intergenic
1135011639 16:18885582-18885604 ATGTGTTAAGTGCATTCTTTTGG - Exonic
1135318541 16:21473165-21473187 ATGTGTTAAGTGCATTCTTTTGG - Intergenic
1135371434 16:21904960-21904982 ATGTGTTAAGTGCATTCTTTTGG - Intergenic
1135440353 16:22465755-22465777 ATGTGTTAAGTGCATTCTTTTGG + Intergenic
1136328797 16:29554908-29554930 ATGTGTTAAGTGCATTCTTTTGG - Intergenic
1136443428 16:30294607-30294629 ATGTGTTAAGTGCATTCTTTTGG - Intergenic
1142792901 17:2282236-2282258 ATTTGTGATGGGCTTTCTATGGG - Intronic
1147247183 17:39130130-39130152 ATGGGTAAAGGGTTTTCTTTTGG + Intronic
1149310620 17:55389485-55389507 ATTTTTAAAAGGTCTTCCTTTGG + Intergenic
1152007666 17:77692744-77692766 TTTTGTAAAGGTCCTGCTGTTGG + Intergenic
1153390080 18:4546618-4546640 ATTTTTTAAGGGGCATCTTTTGG - Intergenic
1153568509 18:6444936-6444958 ATTGATAAAGGGGCATCTTTTGG + Intergenic
1157170100 18:45395887-45395909 GTTTGTTCAGGCCCTTCTTTGGG + Intronic
1157917067 18:51675393-51675415 TTTTGTAAAGTGCCAGCTTTTGG - Intergenic
1158601697 18:58861819-58861841 ATTAATAAAGGCCCATCTTTGGG + Intergenic
1160417158 18:78719484-78719506 ATATGTAAAGTGCCATATTTTGG - Intergenic
1160491764 18:79344102-79344124 AATTGGAAAGGACCTTCTTCCGG + Intronic
1163648138 19:18501891-18501913 CTGTGTTCAGGGCCTTCTTTTGG - Intronic
1166163711 19:40971339-40971361 ATTGGAAAAGGGCATTGTTTAGG + Intergenic
1166535531 19:43571844-43571866 ATTTATTAAGTGCCTTCTGTAGG - Intronic
925623594 2:5819432-5819454 CTTTGTAAATGACCTTCCTTGGG + Intergenic
925697056 2:6591451-6591473 ATTTGGAAAGCACCTTCCTTAGG + Intergenic
927035774 2:19174587-19174609 TTTTGTGAAGGGCCTACTATTGG + Intergenic
927251038 2:20994930-20994952 ATTTGTTAAGCCCCTTCTCTAGG - Intergenic
929673247 2:43896380-43896402 ATTTTTTAAGGGCCTTTTCTTGG + Intronic
930109092 2:47663196-47663218 ATTGGTAAAAGGCCTTCACTGGG + Intergenic
932695501 2:73952888-73952910 ATTTATAAAGAGGCTTATTTTGG + Intronic
932796322 2:74699205-74699227 ACTTCCAAAGGGTCTTCTTTAGG + Intergenic
935937533 2:108202620-108202642 ATTATTAAATGGCCTTGTTTTGG - Intergenic
936960300 2:118066436-118066458 TTTTGAAAAGAGACTTCTTTCGG + Intergenic
937100434 2:119264224-119264246 ATTTCTAAAGGGTCTGCTCTAGG - Exonic
937729052 2:125204894-125204916 ATTTGTGAAGCGATTTCTTTGGG + Intergenic
937796120 2:126022648-126022670 ATTTGAAACTGACCTTCTTTTGG - Intergenic
938993402 2:136652850-136652872 ATTTGTAAAGTACATTCCTTTGG - Intergenic
939860860 2:147418501-147418523 ATTTGTTAAGGAACTCCTTTTGG + Intergenic
940159238 2:150693648-150693670 ATTGGTTAAGGGCCATCCTTGGG - Intergenic
940627206 2:156190266-156190288 ATTTCTAAAAGGCTTTCCTTAGG + Intergenic
940699759 2:157026157-157026179 ATTTGTTATGGCCCGTCTTTTGG - Intergenic
941111147 2:161419301-161419323 ATTTCTAAAGACTCTTCTTTTGG + Intronic
941428578 2:165383372-165383394 ATTTGTGAAGGTCCTTATGTAGG + Intronic
942370716 2:175281288-175281310 ATTTGTTGAGGGCCTACTTTAGG + Intergenic
942900158 2:181106645-181106667 ATTTTTAAAGGTGCTTATTTGGG + Intergenic
945500525 2:210567655-210567677 ATTTCTAAATGTCATTCTTTAGG - Intronic
945650598 2:212554082-212554104 ATTTGGAGAAGACCTTCTTTTGG + Intergenic
948335522 2:237204070-237204092 ATCTGCAAAGAGCCTTATTTTGG + Intergenic
1170708843 20:18770582-18770604 ATTTGTAACTGCCTTTCTTTTGG + Intergenic
1171072096 20:22080602-22080624 ATTTGTACATGGTATTCTTTAGG - Intergenic
1175499149 20:59437294-59437316 ATGTCTAGAGGGCCTTCCTTTGG + Intergenic
1177156432 21:17505879-17505901 ATTTGTAAAGGACATACTTCTGG + Intergenic
1179789822 21:43749858-43749880 GTTTGAAAAGGTCTTTCTTTGGG + Intronic
1184844529 22:47073010-47073032 ATTTATTAAAGGCTTTCTTTTGG + Intronic
949288499 3:2434982-2435004 ATTTGAAAAAGCCCTTCTTGTGG - Intronic
951309576 3:21107469-21107491 ACTTGTAAACAGACTTCTTTCGG + Intergenic
952070278 3:29626013-29626035 ATTTTTAAAGGGCTTTTTGTTGG - Intronic
953565080 3:44025395-44025417 ACTTGAAAAGGGCCTGATTTTGG + Intergenic
954113363 3:48448490-48448512 ATTATTAAAGGGCTTTCATTAGG - Intronic
955155669 3:56414352-56414374 AATGGGAAAGGGCCTTGTTTTGG - Intronic
955216080 3:56985956-56985978 CTTTGAACAGGGCCTTCTCTGGG - Intronic
955443265 3:58979761-58979783 CTTTGTGAAGGCACTTCTTTAGG - Intronic
955547690 3:60048659-60048681 AATTGTATAGGGCCTTATTTTGG + Intronic
956003606 3:64754826-64754848 ATTTATTAAGGGCCTACTATGGG + Intergenic
958510551 3:95041327-95041349 ATTTGAAAAGGGCATTTTTTTGG + Intergenic
958832891 3:99111042-99111064 ATTTGTAAATTACCTTCTCTTGG - Intergenic
959180819 3:102978289-102978311 ATTAAAAAATGGCCTTCTTTGGG + Intergenic
959784246 3:110274537-110274559 ATTTGAAAAGGCCCATTTTTAGG - Intergenic
959908525 3:111737052-111737074 ATTTGTAGAAGGACTTCCTTAGG - Intronic
960035819 3:113102196-113102218 ATTTGCAAATGGCCATCTTCTGG + Intergenic
962359548 3:134726316-134726338 ATTAGTAAAGGCCCGGCTTTGGG + Intronic
962775281 3:138653438-138653460 ATTTATCAAGGCCCTCCTTTTGG + Exonic
963095963 3:141540902-141540924 ATTTCTAGAGGACCTTCTTTGGG - Intronic
966090238 3:176125819-176125841 TTTTGTAAATGGCCTTTATTAGG + Intergenic
967151684 3:186656842-186656864 ATTTTTAAAAGTCCTTCTCTTGG + Intergenic
967547510 3:190749191-190749213 ATTTAAAAAGGACCCTCTTTGGG - Intergenic
967637311 3:191818364-191818386 ATCTTTAAAGCCCCTTCTTTAGG - Intergenic
968216996 3:196900970-196900992 ATCTGGAGAGGGCCTTTTTTTGG + Intronic
969077066 4:4588427-4588449 TTATGGTAAGGGCCTTCTTTTGG - Intergenic
969996043 4:11314377-11314399 ATTTGTAAAAGCCTTTCTGTTGG - Intergenic
970208893 4:13686494-13686516 ATTGCTAAAGGGAGTTCTTTAGG - Intergenic
970899745 4:21144956-21144978 AATTTTAGAGGGCCATCTTTAGG + Intronic
971159312 4:24117485-24117507 ATTTTCAAAGGGCCTTCTAGTGG + Intergenic
971359453 4:25923297-25923319 ATTTGTAAAAGGCCATATTCAGG - Intronic
972653862 4:41047487-41047509 ATTTGTTGAGGGCTTCCTTTGGG + Intronic
973051026 4:45596576-45596598 ATTTGTAGAGGGCTGTCTTCTGG - Intergenic
975748982 4:77503120-77503142 ACTTGTATAGGCCCTTCTTCTGG + Intergenic
976380521 4:84393377-84393399 ACTTGTCAAGGGATTTCTTTAGG - Intergenic
976556807 4:86460106-86460128 ATTTTTAAAGAGTCTTCTATGGG + Intronic
977139967 4:93357538-93357560 ATTTAGAAAGGTCTTTCTTTTGG + Intronic
977156911 4:93585548-93585570 ATTTGTAAACTGCTTTCTTGTGG + Intronic
978387392 4:108189915-108189937 AATTTTAAAGGGTTTTCTTTTGG + Intergenic
980843377 4:138294245-138294267 AATTGTAAATGGCTTTCCTTTGG - Intergenic
981554603 4:145979176-145979198 ATGTGCAAAGGGCATCCTTTAGG + Intergenic
981777769 4:148389783-148389805 ATTCATAAAAGGCATTCTTTTGG + Intronic
982034872 4:151336026-151336048 ATGTGAAAAGTGCCTTCTTTGGG - Intergenic
983180984 4:164648840-164648862 ATGTGTAAAGGGACATCTTTAGG - Intergenic
983995272 4:174174985-174175007 ACTTGTAAATGGCCGTCTTCTGG - Intergenic
984618465 4:181925971-181925993 GTTTGTAAACAGCCTTGTTTTGG + Intergenic
986578219 5:9234917-9234939 ATTAGGAAAAGGCCATCTTTTGG - Intronic
987621994 5:20346649-20346671 ATTTGTAAAGAGCCATCTAGAGG - Intronic
988726024 5:33927352-33927374 ATTTGAAAAGGGATTTTTTTAGG + Intergenic
989281435 5:39648637-39648659 TTTTGTCAAGGGCCTTGCTTTGG + Intergenic
989582399 5:43045188-43045210 ACTTGTCAAGGCCCTTCTCTGGG - Intergenic
992536912 5:77715658-77715680 ATTTATAAAAAGTCTTCTTTGGG + Intronic
993066297 5:83102450-83102472 ATTTGTGGAAAGCCTTCTTTGGG + Intronic
997740820 5:136252248-136252270 AATTGTAAAGGGCTTTCTGAAGG + Intronic
998343463 5:141439798-141439820 GTTTGAAAAGGGGCTTATTTGGG + Intronic
998770288 5:145536090-145536112 ATTTTTAAAGAGCTTTGTTTTGG - Intronic
998812199 5:145977568-145977590 ATTTGGAAAGGGCATCTTTTTGG - Intronic
998995492 5:147866115-147866137 CTTTGGGAAGAGCCTTCTTTGGG - Intergenic
999853763 5:155571168-155571190 ACTATTAAAGGGCATTCTTTAGG - Intergenic
1004619836 6:17322773-17322795 ATTAGTAATGGGGGTTCTTTTGG + Intergenic
1005094136 6:22094164-22094186 ATTTGTAAGGAGGCTGCTTTAGG - Intergenic
1005134253 6:22549419-22549441 ATTTGTGAAGGTCCTTTTTTGGG + Intergenic
1006298195 6:33179350-33179372 TTCTGGAAAGGGGCTTCTTTTGG - Intronic
1007980290 6:46148053-46148075 TTTTATAAAGGGGCTTCTATAGG + Intergenic
1008226797 6:48929181-48929203 ATTTGTAAAAGGAGTGCTTTGGG + Intergenic
1008582070 6:52916571-52916593 CTTGGTTTAGGGCCTTCTTTAGG + Intergenic
1008811703 6:55509226-55509248 ATTTGGAAAGGAACTTCTGTGGG + Intronic
1009780103 6:68258801-68258823 ATCTGTAAAGGGCCCTTTTCAGG + Intergenic
1010817185 6:80372179-80372201 TTTTGTAGAGGTCCTTGTTTAGG + Intergenic
1011632096 6:89337475-89337497 ATCTGTAGAGGGCCTACTCTGGG + Intronic
1011877757 6:91982570-91982592 ATTTGTAAAATGCCTTCTATAGG - Intergenic
1012440275 6:99255734-99255756 TTTTGTGAATGGCTTTCTTTTGG - Intergenic
1013533365 6:111040630-111040652 ATTTGTAAATGGGCTGATTTAGG - Intergenic
1015985475 6:138880276-138880298 ATCTGTCAAGGGCCTTCTCTTGG + Intronic
1021130317 7:16904245-16904267 AGTAGTTAAGGGCATTCTTTTGG - Intergenic
1021159392 7:17253273-17253295 ATTTATTGAGGGCCTTCTCTGGG - Intergenic
1022594642 7:31700902-31700924 ATTTGAAAAGGGTCTTTTTTTGG - Intronic
1025702888 7:63836075-63836097 TTTTTTAAAGGGCCCTGTTTTGG + Intergenic
1026636388 7:72085639-72085661 ATTTGTCAAGGGACTACTTGGGG + Intronic
1029234012 7:99097569-99097591 ATCTGGCAAGGGCCTTCTTGTGG - Intronic
1030746390 7:113171786-113171808 ATGTGGAAATGACCTTCTTTGGG + Intergenic
1031465332 7:122103148-122103170 AATTATAAAGGGACCTCTTTGGG - Intronic
1036226617 8:6964308-6964330 CTTTGTAAAGCCCCTCCTTTGGG - Intergenic
1037148812 8:15609809-15609831 AGTTGAAAATGGCCTTTTTTTGG - Intronic
1037972923 8:23187067-23187089 ATTTGGTGAGGGCCTTCTTGTGG - Intergenic
1038112033 8:24510683-24510705 ATTTTTAAATGGCCTTCCATAGG + Intronic
1041251288 8:55937131-55937153 AATTGTATAGTGTCTTCTTTAGG + Intronic
1042114342 8:65414722-65414744 ATTTGTAAAATGACTTTTTTAGG - Intergenic
1043959162 8:86395918-86395940 ATTTTAAAAGGCTCTTCTTTAGG + Intronic
1043974101 8:86565639-86565661 ATTTGAAAAAGGCCTGCTTTAGG + Intronic
1044240560 8:89883487-89883509 ATTTGAAAAGGGTGTCCTTTTGG - Intergenic
1044547246 8:93473422-93473444 CTTTGTAAAGACCCTTCTTGTGG - Intergenic
1044571654 8:93725309-93725331 ATTTTTAAAGGGTTTCCTTTAGG - Intronic
1046250063 8:111619101-111619123 AATTCTAAAGGGTCTACTTTAGG - Intergenic
1046856522 8:119038709-119038731 ATTTGTGAAGTTCCCTCTTTTGG + Intronic
1051670764 9:19507876-19507898 TTTTGTAAAGGATCTTTTTTAGG - Exonic
1053449770 9:38183376-38183398 ATTTGTGAAGGAGCTTCTGTGGG + Intergenic
1053905487 9:42839977-42839999 GTTTCAGAAGGGCCTTCTTTGGG - Intergenic
1054983498 9:71234569-71234591 ACTTGTAAATGGTCTTCTCTCGG + Intronic
1056983724 9:91341665-91341687 ATTTGCTAAGTGCCTTCTATGGG + Intronic
1057613777 9:96569886-96569908 CTTTGTAAAGAGCCCTGTTTCGG - Intronic
1060049299 9:120366058-120366080 ATTTGTCAAGGGGCTGCATTTGG + Intergenic
1185780463 X:2839911-2839933 ATGGGTACAGGGCCTCCTTTTGG + Intronic
1187325483 X:18282815-18282837 ATTTGTTCTGGGGCTTCTTTTGG - Intronic
1188745021 X:33830736-33830758 ATTTGTTAAGGGCCGTCCTTGGG + Intergenic
1188931863 X:36121640-36121662 AGTTCTTAAGGGCTTTCTTTTGG - Intronic
1189776306 X:44472850-44472872 ATTTTTAAAGGCACTTATTTGGG + Intergenic
1190453736 X:50605915-50605937 ATTTGTTAAGTGCCTACTATTGG + Intronic
1193747113 X:85295869-85295891 ATTTGTAAAAGAAGTTCTTTTGG - Intronic
1195066650 X:101243603-101243625 ATTTATTGAGGGCCTTCTGTGGG + Intronic
1195675220 X:107502686-107502708 ATTTGTCAAGGGCTTTTTTTTGG - Intergenic
1196033346 X:111115316-111115338 ATTTCTAAAGAGACTGCTTTGGG + Intronic
1196818099 X:119681000-119681022 ATTTGTATAGTTCCTACTTTAGG + Intronic
1199178647 X:144824985-144825007 CTTTGTAAACTGCCTTCTATTGG + Intergenic
1199940744 X:152625269-152625291 ATGTGTAAAGGGTCTCCTTTGGG + Intergenic
1200865915 Y:8043144-8043166 ATTTGTCAAATGCCCTCTTTAGG - Intergenic
1201289595 Y:12410067-12410089 ATGGGTACAGGGCCTCCTTTTGG - Intergenic