ID: 901567720

View in Genome Browser
Species Human (GRCh38)
Location 1:10132465-10132487
Sequence AAGAAAGCACAGATGCAGGT AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 498
Summary {0: 1, 1: 0, 2: 3, 3: 41, 4: 453}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901567714_901567720 27 Left 901567714 1:10132415-10132437 CCCGTGAGGCTGCTCTCAGTTAC 0: 1
1: 0
2: 0
3: 14
4: 137
Right 901567720 1:10132465-10132487 AAGAAAGCACAGATGCAGGTAGG 0: 1
1: 0
2: 3
3: 41
4: 453
901567715_901567720 26 Left 901567715 1:10132416-10132438 CCGTGAGGCTGCTCTCAGTTACA 0: 1
1: 0
2: 0
3: 15
4: 185
Right 901567720 1:10132465-10132487 AAGAAAGCACAGATGCAGGTAGG 0: 1
1: 0
2: 3
3: 41
4: 453

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901567720 Original CRISPR AAGAAAGCACAGATGCAGGT AGG Exonic
900814107 1:4830126-4830148 AAGTAAACACAGAAGTAGGTGGG + Intergenic
900833805 1:4984844-4984866 CAGAACTCACAGATGCAGCTTGG - Intergenic
901136947 1:7003650-7003672 AAGGAATCACTCATGCAGGTAGG + Intronic
901525177 1:9816979-9817001 GAGAAAGTACAGATCAAGGTAGG + Intronic
901567720 1:10132465-10132487 AAGAAAGCACAGATGCAGGTAGG + Exonic
902603457 1:17555768-17555790 AAGCAAGAACAGATGCAGGTGGG - Intronic
902935516 1:19762027-19762049 AAGAAAGAACAGGTGCAGAGTGG + Intronic
903564961 1:24258327-24258349 AAGAAAGCCCAGATTCAGAGAGG - Intergenic
903570500 1:24301026-24301048 CAGAAAGCACAGGTCCAGGCAGG + Intergenic
904638674 1:31904595-31904617 ACAGTAGCACAGATGCAGGTGGG + Intergenic
905357492 1:37394944-37394966 GAGAAAGCACAGAAGCAGCAAGG + Intergenic
905524485 1:38625846-38625868 AGGAAAGGAGAGATGAAGGTGGG + Intergenic
905660289 1:39717309-39717331 AAAAAAGCACAGATGGAATTGGG - Intronic
905745848 1:40416752-40416774 AAGAAAACACACATACAGGTTGG - Intronic
906822493 1:48944166-48944188 AAGGAAGCTCAGATGGTGGTGGG + Intronic
907139131 1:52168974-52168996 AACAAAGCACAGATTAAGGGAGG - Intronic
907172235 1:52479212-52479234 AAGAAAGCAAAGAGCCAGGAAGG + Intronic
909222101 1:72978434-72978456 GAGAAAGCACAGTTGCAGATTGG + Intergenic
910368002 1:86487214-86487236 AATAAAACACAGATGCACGCAGG - Intronic
910402374 1:86850145-86850167 AAGAAAGCAATGATGGAGATGGG - Intergenic
910860330 1:91737202-91737224 AAGAAAGCAAAGCTGCAGTGAGG + Intronic
911943340 1:104074247-104074269 AAGAAGGAACAGATGTGGGTGGG - Intergenic
912144894 1:106781629-106781651 AAGAAAGAAAAGATGAAGGAAGG + Intergenic
912309971 1:108610341-108610363 ATGTGGGCACAGATGCAGGTAGG + Intronic
912338543 1:108887317-108887339 AAAAAACCACACAGGCAGGTGGG + Intronic
912853119 1:113144261-113144283 AAGAAAGCAAAAGTGTAGGTGGG + Intergenic
914728717 1:150351473-150351495 AAGATAACAAATATGCAGGTGGG - Intronic
915940252 1:160114331-160114353 AAGAAAGCAGAGAGGAAGGGAGG - Intergenic
916077772 1:161212463-161212485 AAGCGAGCAGAGATGAAGGTTGG + Exonic
916538208 1:165724881-165724903 CAGAAAGGGCAGAAGCAGGTGGG + Exonic
916578294 1:166086338-166086360 AAGAAAGCACAGTGGCAGAAGGG + Intronic
916840812 1:168598641-168598663 AAGAAATCACAGAGGCATGAGGG - Intergenic
917469583 1:175314983-175315005 ATGAAAGCACAGAAACAGGGCGG + Intergenic
917475135 1:175362884-175362906 AATAAAGCACAGATGGGTGTGGG + Intronic
917887683 1:179402449-179402471 ATATAAGCACAGATGCAGGTGGG - Intronic
920585715 1:207158051-207158073 GAGAAAGCACATAGGCAAGTAGG + Intergenic
920979290 1:210817540-210817562 AAGAAAACACCCAGGCAGGTTGG + Intronic
921186211 1:212671757-212671779 AAGAAAACACAAATACTGGTAGG + Intergenic
921293849 1:213683758-213683780 AAGAAATCACAGCAACAGGTGGG - Intergenic
921397861 1:214687850-214687872 AACAAAACACATATGCAGGATGG + Intergenic
921843527 1:219854555-219854577 AAGAAACAACAGATGCTGGAGGG - Intronic
923115753 1:230936028-230936050 GAGAAAGGGCAGCTGCAGGTGGG + Intronic
923124743 1:231025265-231025287 AAGAGACCTCAGCTGCAGGTCGG + Intronic
923344889 1:233042207-233042229 AATATGGCACAGATGCAGGTAGG - Intronic
923449391 1:234102491-234102513 AAGAAAGCACAGATACTGAAAGG - Intronic
923666514 1:236003018-236003040 CAGGAAGCAGAGATGCAGGTGGG - Intronic
924105549 1:240645573-240645595 AAGAAAGCACAGAGAAAAGTGGG - Intergenic
924206570 1:241717999-241718021 AAGAAAACTCAGATGCAGAGAGG + Intronic
924307033 1:242700337-242700359 AAGAAAGAACAAATGGAGGGAGG + Intergenic
924661266 1:246019665-246019687 AAGATAGCACAGATGGACCTAGG - Intronic
924759678 1:246972124-246972146 GAGAAAGCACTGTAGCAGGTCGG + Intronic
924908010 1:248477627-248477649 AAAGAAGCAAAGAAGCAGGTAGG - Intergenic
924916098 1:248570456-248570478 AAAGAAGCAAAGAAGCAGGTAGG + Intergenic
1063220372 10:3961736-3961758 AAGAAAGAACATATGCAGAGTGG + Intergenic
1063239041 10:4149456-4149478 AAGAAGACACAGAGGCAGCTGGG - Intergenic
1063239045 10:4149482-4149504 AAGAAGACACAGAGGCAGCTGGG - Intergenic
1063239049 10:4149508-4149530 AAGAAGACACAGAGGCAGCTGGG - Intergenic
1063239053 10:4149534-4149556 AAGAAGACACAGAGGCAGCTGGG - Intergenic
1063239057 10:4149560-4149582 AAGAAGACACAGAGGCAGCTGGG - Intergenic
1065033674 10:21614637-21614659 AAAAAAGATCAGTTGCAGGTTGG + Intronic
1065035102 10:21630055-21630077 AAGAAAGAAGAGAAGCATGTAGG + Intronic
1066010468 10:31189685-31189707 CAGAAATCAGAGATGCAGCTAGG + Intergenic
1066420209 10:35258424-35258446 AAGAAAGAAAAAATGAAGGTGGG + Intronic
1068073148 10:52221049-52221071 AAAAAATAACAGATGCGGGTGGG - Intronic
1068747034 10:60544427-60544449 AAGAAAGCAGAAATGCAGCAGGG - Intronic
1069122327 10:64582412-64582434 AAGAAACAGCAGATGCTGGTGGG - Intergenic
1069778605 10:70941108-70941130 AAGGAAGCACAGAGGCAGCAGGG + Intergenic
1070194045 10:74140090-74140112 AAGGATGCTCAGCTGCAGGTGGG - Intronic
1071034992 10:81233953-81233975 AAGAAATAACAGATGCTGATGGG - Intergenic
1072341413 10:94455506-94455528 CAGAAAGCACAGACCCAGATGGG - Intronic
1072718706 10:97767868-97767890 AAGAAAGGACAGGGGCAAGTTGG + Intronic
1073119431 10:101112547-101112569 AAGAAAGCTGAGGTGGAGGTGGG + Intronic
1073440611 10:103550379-103550401 ATGAGAGGACAGATGCAGCTGGG + Intronic
1073483930 10:103804903-103804925 TGGGAAGCAGAGATGCAGGTGGG - Intronic
1075583708 10:123642431-123642453 AAGAAACCACAGATGCAAAGAGG + Intergenic
1076075522 10:127530906-127530928 AAGAAAGGCCAGAAGCAGCTTGG - Intergenic
1076890174 10:133279451-133279473 GAGCAAGCAAAGATGCATGTGGG - Exonic
1078287205 11:9969073-9969095 AAGAAAGCAGGGATAGAGGTGGG - Intronic
1078559349 11:12357043-12357065 AAGAAAGAAGAGAGGCAGGAGGG - Intronic
1078734621 11:14008617-14008639 AAGTGAGGAAAGATGCAGGTAGG - Intronic
1079102853 11:17552374-17552396 AAGAAGCCACAGAACCAGGTGGG - Intronic
1079768664 11:24429528-24429550 GAGAAAACAGAAATGCAGGTAGG - Intergenic
1080030976 11:27660725-27660747 AAGAAAGCAAAAATGCAGCCTGG + Intronic
1080398683 11:31914028-31914050 AAAAAATAACAGATGCTGGTGGG - Intronic
1082957009 11:58880616-58880638 AAGAAAGCTCTGTTGGAGGTGGG + Intronic
1083103256 11:60332487-60332509 ATGAAAGCTGAGATGCAGATGGG - Intergenic
1083103356 11:60333600-60333622 ATGAAAGCTGAGATGCAGATGGG + Intergenic
1083226203 11:61286504-61286526 AAGAAAGCACCCTTGCAGGCCGG + Intronic
1083986478 11:66219114-66219136 GAGAAAGACCAGAAGCAGGTGGG + Intronic
1084716558 11:70878006-70878028 AAGAATGCAGAGAAGCAGGAGGG + Intronic
1084732874 11:71084669-71084691 AAGAAATTACAGGGGCAGGTGGG - Intronic
1085058232 11:73420731-73420753 AAGAAAGCACATATGAAATTTGG + Intronic
1085444887 11:76593950-76593972 AAGAAATCAGAGATGGTGGTCGG + Intergenic
1085577165 11:77616588-77616610 AAGAAAGAACTGGTTCAGGTTGG + Exonic
1085721116 11:78913218-78913240 ATGAAAGCAGAGAAGCAGGAAGG - Intronic
1085791700 11:79502281-79502303 AAGAAAGCAGAGGTACAGGCAGG - Intergenic
1085885378 11:80515627-80515649 AATACAGCAAACATGCAGGTGGG - Intergenic
1086208382 11:84287661-84287683 AAGAAAGGAGAGATGGAGGGAGG - Intronic
1086751520 11:90500659-90500681 AGGACAGCACTGATGAAGGTGGG + Intergenic
1088486887 11:110349273-110349295 AAGACAGCACAAATGCATTTTGG - Intergenic
1090088052 11:123668608-123668630 AACAAAGAACAGATTCAGGGTGG + Intergenic
1090421202 11:126576235-126576257 AAGGAAGGACAAATGAAGGTAGG - Intronic
1090908218 11:131095941-131095963 AACAAATCACAGATGCACGAGGG + Intergenic
1091982482 12:4877572-4877594 AAGAAAGAACAGGTGTAGGAGGG - Intergenic
1092866034 12:12762289-12762311 AAGACAGAGCTGATGCAGGTAGG + Intronic
1093241556 12:16682957-16682979 AGATAAACACAGATGCAGGTAGG - Intergenic
1095849425 12:46785793-46785815 AAGAAACCATACATGCATGTGGG - Intronic
1096575980 12:52553090-52553112 GACAAAGCTCAGATGCAGGAGGG + Exonic
1097327439 12:58293729-58293751 AAGAAAACAGATATGCAGGGAGG + Intergenic
1099175322 12:79414766-79414788 AAGAAAGCAGAGATGAATGAGGG + Intronic
1099317935 12:81107837-81107859 AAGAATGAACACCTGCAGGTGGG - Intronic
1099417400 12:82408415-82408437 AAAAAAACACAGATGCAAGAGGG + Intronic
1100176063 12:92032192-92032214 ATGAAGGCACAGAAGCTGGTTGG + Intronic
1100795909 12:98181741-98181763 AAGAAAGCAGAAAGGAAGGTAGG + Intergenic
1101237780 12:102806624-102806646 AAGAAAGCAGAAATGCATGGAGG + Intergenic
1101264610 12:103070682-103070704 AAGAAAACAGAAATGCAGGTAGG + Intergenic
1102355912 12:112235420-112235442 TAGGAAGCACAGATGCAAGGGGG + Intronic
1103167718 12:118784615-118784637 AAGAGAACAAAGAGGCAGGTTGG + Intergenic
1103173050 12:118838395-118838417 AGGATAGAACAGATGCAGGGAGG - Intergenic
1105562301 13:21505329-21505351 CAGAAGGCACTGATGCAGGGCGG + Intronic
1105620236 13:22059626-22059648 AAGGAAGAACCCATGCAGGTAGG + Intergenic
1105641962 13:22275118-22275140 TAGAAAGCCCAGAAGCAAGTGGG - Intergenic
1108787593 13:53924257-53924279 AAGAAATAATAGATGTAGGTGGG - Intergenic
1109474034 13:62854816-62854838 AAGAAGGTACAGATACATGTGGG + Intergenic
1109850687 13:68059001-68059023 AAGAAAGCAAACATCCATGTAGG - Intergenic
1110314768 13:74093104-74093126 TAGAAAGTTCAGATGTAGGTAGG - Intronic
1110844585 13:80179795-80179817 AAAAAAGCACAGAAGCAGGAAGG + Intergenic
1111162101 13:84408082-84408104 AAGAAGCCACTGATGCAGGTGGG + Intergenic
1111536509 13:89608427-89608449 AAAAAATCACAGATTCATGTGGG + Intergenic
1112574924 13:100627186-100627208 CAGAGAGCAGGGATGCAGGTTGG + Intronic
1112773065 13:102812842-102812864 TTGAAAGCACAGATACAGGGGGG - Intronic
1113496252 13:110731854-110731876 AAGTACTCACAGATGCTGGTGGG - Intergenic
1114598055 14:23931110-23931132 AAGAGAGCACAGCAGCAGGCTGG - Intergenic
1116181046 14:41536113-41536135 AAAAAACAACAGATGCTGGTGGG - Intergenic
1116826552 14:49678297-49678319 AAGAAAGCAGAAAAGCAGGCTGG - Intronic
1117346189 14:54835244-54835266 AACAAAGGACAGACTCAGGTGGG - Intergenic
1117433107 14:55689717-55689739 AAGAAAGCCCAGCTGAAAGTGGG - Intronic
1117864956 14:60137401-60137423 AAGAAAAACCAGATGCAGTTAGG + Exonic
1119230413 14:72974975-72974997 AACAAAACAGAGAGGCAGGTAGG + Intronic
1120821549 14:88915946-88915968 AAGAAAGCACACCTGAAGGCAGG + Intergenic
1120943743 14:89974447-89974469 CAGAATGCACAGATGCATGCTGG + Intronic
1121742851 14:96266255-96266277 AAGTAGGCCCAGAGGCAGGTGGG + Intronic
1122687205 14:103514994-103515016 CAGAGAGCAGACATGCAGGTGGG + Intergenic
1122814345 14:104304959-104304981 AAGAAAGGACAGAGGCAGACTGG - Intergenic
1124057862 15:26259205-26259227 AAGAAATGACAAATGCAGGCCGG - Intergenic
1124717655 15:32080635-32080657 AAGAAACAACAGATGCTGGCAGG + Intronic
1124799472 15:32816528-32816550 AAGAAACAACAGATGCTGTTTGG + Intronic
1125501959 15:40245491-40245513 AAGAAAGCACAGAGGGTGGAGGG + Intronic
1126539115 15:49802807-49802829 AAGAAAGCACAGAGGTGGGCCGG - Intergenic
1127531653 15:59849253-59849275 AAAAAAGCACAGGTGGAGGCGGG + Intergenic
1128347472 15:66863611-66863633 AAGAGAGCACAGATCCAAGTGGG - Intergenic
1128367860 15:67017396-67017418 AAAAAAGAAAAGATGCAGCTGGG + Intergenic
1128785107 15:70389565-70389587 AAGAAAACACAAATGCATATAGG + Intergenic
1129198917 15:73987018-73987040 AAAGCAGCACAGAGGCAGGTGGG + Intronic
1130750315 15:86704625-86704647 AGGAAACAACAGATGCTGGTAGG + Intronic
1130857700 15:87855755-87855777 AACAGAGCAGAGATGCAGTTTGG - Intergenic
1130885274 15:88087486-88087508 CAGAAAGCACTGTTGCAAGTGGG + Intronic
1131731931 15:95290980-95291002 AAGAAAGCACAGGTGGGGGCAGG + Intergenic
1131815026 15:96213177-96213199 AGGGAAGTACAGATGCAGGAAGG - Intergenic
1133722622 16:8508998-8509020 CAAAAAACACAGATGCCGGTGGG + Intergenic
1135175421 16:20223566-20223588 AAAAAAGGAAAGAAGCAGGTTGG - Intergenic
1135953356 16:26935771-26935793 AAAAAAGCTCAGAGGCAGGGAGG + Intergenic
1136850893 16:33611455-33611477 AAGAAAGCAAAAATTCACGTTGG - Intergenic
1137511325 16:49103285-49103307 AAGAAAGCACAAATCCCAGTTGG - Intergenic
1137805778 16:51304111-51304133 AAAAAAGCACTGATCCAAGTTGG + Intergenic
1138424906 16:56924911-56924933 TAAAAAGCACAGATTCTGGTTGG + Intergenic
1138527751 16:57618922-57618944 AAGAAAGCACAGACGGTGGATGG - Intronic
1138864040 16:60794897-60794919 AAGAAAGCAAAGAAACAGGCAGG - Intergenic
1139823790 16:69741078-69741100 AAAAAAGCACAGATGGGGCTGGG + Intergenic
1140049050 16:71463303-71463325 AAGAAGCCACAGAGGCAAGTGGG - Intronic
1141280017 16:82622940-82622962 CAAAGGGCACAGATGCAGGTTGG + Intergenic
1141742799 16:85905211-85905233 CTGAAGGCACAGTTGCAGGTTGG + Intronic
1141916355 16:87099791-87099813 AAGAAAGCACACTGGGAGGTGGG + Intronic
1143037393 17:4007254-4007276 AACAGTGCAAAGATGCAGGTGGG + Intronic
1143275462 17:5706552-5706574 AAGGCAGCAAAGAAGCAGGTAGG - Intergenic
1143741339 17:8956216-8956238 AAAAAAAAAAAGATGCAGGTTGG + Intronic
1144948449 17:18981631-18981653 AAGCAACCACAGAGGCAGGCAGG + Intronic
1146571404 17:33956478-33956500 TGGAAAGCAGAGATGGAGGTTGG - Intronic
1147056348 17:37838355-37838377 AAGTGAGCACAGATTCAGGAGGG - Intergenic
1147474287 17:40695237-40695259 AAGAAAGCCCATGTGCATGTGGG + Intergenic
1147575116 17:41594545-41594567 AAGGAAGCACAGAGGGAGGGAGG + Intergenic
1147777134 17:42910145-42910167 AAGAAAACACATATTCAGGCAGG - Intronic
1148876892 17:50693431-50693453 AAGACTGCACAGTTGCTGGTAGG - Exonic
1149898442 17:60450137-60450159 AAGAAAACACTGATGCAGGCTGG + Intronic
1149938371 17:60833209-60833231 AAGACAGCACAGATGCACAAGGG - Intronic
1150582511 17:66487669-66487691 AAAAAAGAACAGATACTGGTGGG - Intronic
1150931033 17:69585665-69585687 AAAAAACAACAGATGCTGGTAGG + Intergenic
1151023438 17:70647265-70647287 AAGAAAGAACAGACACAGATGGG - Intergenic
1151247817 17:72808749-72808771 TAGGAATCACAGATCCAGGTGGG - Intronic
1151638521 17:75370834-75370856 AATAAAGAACAAATTCAGGTGGG + Intronic
1152601523 17:81264662-81264684 TAAAAAGCACAGCTGGAGGTGGG + Intronic
1152831420 17:82499368-82499390 CAGAAAGCAAAGATGCAGAAGGG - Intergenic
1154167761 18:12028807-12028829 AAGGGAGGACAGATGCAGGCGGG - Intronic
1155441414 18:25866211-25866233 AAGAAATCACAGCTGCAGTTGGG - Intergenic
1155791119 18:29971837-29971859 AAGAAGACACAGAGGCAGGCTGG - Intergenic
1156102655 18:33616689-33616711 CAGAAAGCCCAGATTAAGGTTGG + Intronic
1156475821 18:37404691-37404713 AAGAAAGCAGAGAGCCAGGATGG + Intronic
1157466789 18:47954154-47954176 AAGAAACCACAGTTACTGGTAGG - Intergenic
1157506989 18:48233743-48233765 AAAAAAGCACAGATGAATATGGG - Intronic
1158564929 18:58546743-58546765 AGGAAAACACAGATGCATGCAGG - Intronic
1158684317 18:59599202-59599224 AAGAAAGGAGAGATGAAGGCTGG + Intronic
1159037665 18:63293155-63293177 AAGATAGCACACAAGCAGCTGGG + Intronic
1159852363 18:73539751-73539773 AAGAAAGCACAAACACAGGTTGG - Intergenic
1160590134 18:79939717-79939739 AAAAAATAACAGATGCTGGTGGG + Intronic
1161795408 19:6383536-6383558 CTGCAAGCACAGATGCAGGGTGG - Intronic
1161952942 19:7477714-7477736 CAGAAAGCACAAATGCACTTTGG + Intronic
1163792700 19:19317211-19317233 AGGAGAGTACATATGCAGGTAGG + Intronic
1164810656 19:31152738-31152760 AAGGAAGCACAGAGGAAGTTAGG - Intergenic
1164880997 19:31732745-31732767 AAGAAAGCACGGGTGGAGGCTGG + Intergenic
1165396328 19:35565713-35565735 AAGAAAACACAGTGTCAGGTTGG - Intergenic
1167451079 19:49569837-49569859 AAAAAAGAACACTTGCAGGTGGG + Intronic
925487802 2:4355311-4355333 AAGAAAACACAGATGTATGGGGG + Intergenic
926188897 2:10712557-10712579 CAGAGAGCACAGATGAAGGGCGG + Intergenic
926296421 2:11572311-11572333 AAGAAAGGTCAGGTGCAGGTGGG + Intronic
926368786 2:12159654-12159676 AAGAAAGGAAAGAAGGAGGTAGG - Intergenic
927393754 2:22625922-22625944 AAGAAAGAAGAGATGTAGGGAGG + Intergenic
928067545 2:28181676-28181698 AAAAAAGTACAGATTTAGGTTGG + Intronic
928186828 2:29117728-29117750 ATGAAAGCACAGATTCAAGAGGG - Intronic
928267750 2:29826083-29826105 AGGGAAGGACAGTTGCAGGTGGG - Intronic
928467752 2:31538636-31538658 AAGAGAGCAGAGATGTAGTTGGG - Intronic
929396633 2:41531239-41531261 GAGAAAGCACACAAGGAGGTTGG + Intergenic
929763213 2:44823262-44823284 AAGACAGTGCAGAAGCAGGTGGG - Intergenic
930405844 2:50954628-50954650 AAGAAAGAAGAGAAGCAGGCAGG + Intronic
931561105 2:63561862-63561884 AAGAAACAACAGATGCTGGCGGG + Intronic
931664389 2:64599866-64599888 AGCAAAGCACAGATTCAGGAAGG - Intergenic
931787448 2:65632871-65632893 AAGAAATTACAAATGCAGCTAGG - Intergenic
931821909 2:65960757-65960779 AAGAAACCACAGAATCAGATTGG + Intergenic
933635124 2:84700338-84700360 ATATGAGCACAGATGCAGGTAGG + Intronic
934578461 2:95418395-95418417 AAGAGAGCACTGATGCATGAAGG + Intergenic
935091802 2:99901736-99901758 GAGAAAGAGCAGATGCAGGGAGG - Intronic
935555002 2:104499740-104499762 AATTAAGCAAAGATGCAGGGAGG + Intergenic
935667494 2:105525384-105525406 AAGCACGCACACATGCAGCTTGG - Intergenic
936534353 2:113300467-113300489 AAGAGAGCACTGATGCATGAAGG - Intergenic
937591944 2:123624911-123624933 AAAAAAGGATAGATGCTGGTTGG + Intergenic
939186423 2:138866406-138866428 AAAAAATCAAAGATGCAGGATGG - Intergenic
939352902 2:141063655-141063677 AGGAAAACAGAGATGCAGGATGG - Intronic
939999414 2:148951835-148951857 GAGAAAGGACAGATGGGGGTGGG + Intronic
941275591 2:163486819-163486841 AGGACAGGACAGATACAGGTGGG - Intergenic
941466985 2:165839559-165839581 AAGGAAGCAGAGATGGAGGGAGG + Intergenic
941513779 2:166446362-166446384 AGGAAACAACAGATGCAGGCAGG + Intronic
941658542 2:168170658-168170680 AAGAAGGCAGAGAGGAAGGTTGG + Intronic
941747039 2:169097896-169097918 AAGAAAGAACACAATCAGGTAGG - Intergenic
942507704 2:176661145-176661167 AACCAAGCACAGCGGCAGGTGGG + Intergenic
942818483 2:180081331-180081353 AGGAAAATACAGATGCAGGAGGG - Intergenic
943003417 2:182358986-182359008 AAGAAAGGACAGAGGAAGGAAGG - Intronic
944659250 2:201907207-201907229 GAGAAAGCACTGTTGCAGGCCGG + Intergenic
944690065 2:202150805-202150827 AAGAAAGCAGAGATGCCTGAAGG - Intronic
945198167 2:207256793-207256815 AACAAAGGACAAATGCAGGAAGG - Intergenic
945444975 2:209926132-209926154 AAGAAAACACACATGCATTTAGG - Intronic
945703880 2:213204772-213204794 GAGAAAGCAAAGATACAGATTGG - Intergenic
946049901 2:216853834-216853856 AAGTAAGCTCAGATTCAGATAGG + Intergenic
946725856 2:222660418-222660440 AAGAAAGAAAAGATGAAGGTGGG + Intergenic
946832100 2:223737411-223737433 TAGAGAGCTCAGCTGCAGGTCGG - Intergenic
946878366 2:224152862-224152884 AAAAAATAACAGATGCTGGTGGG - Intergenic
947079999 2:226385485-226385507 AAAAAAGCACAGTTGGAGGATGG - Intergenic
947114746 2:226757053-226757075 AAGCAAGCACATAAGCAGTTAGG - Intronic
947254683 2:228148684-228148706 AAGGCAGCAGAGAGGCAGGTAGG + Intronic
948708602 2:239811187-239811209 ATGAAAGCACAGTTCCAGCTTGG + Intergenic
1169959021 20:11138091-11138113 AAGAAAGTAGGGATGAAGGTAGG - Intergenic
1170157041 20:13278449-13278471 AAAAGACCACAGGTGCAGGTGGG - Intronic
1170548722 20:17457101-17457123 AAGAAAGTAGAGTAGCAGGTGGG - Intronic
1171958575 20:31477324-31477346 AAGATAGAAGAGATGAAGGTAGG + Intronic
1172611114 20:36253173-36253195 AAGACAGCGGAGAAGCAGGTGGG + Intronic
1172907784 20:38381815-38381837 AAGAAAGAAGAAATGCAGCTGGG - Intergenic
1173280413 20:41621908-41621930 AAGAGAGAACAGATTCGGGTGGG - Intergenic
1173375624 20:42480184-42480206 AATAAGGCACAGACACAGGTAGG - Intronic
1173529333 20:43756615-43756637 AAAATAGCACAGATGAAGGCTGG + Intergenic
1174718180 20:52782973-52782995 AAGAAAACACAGAAGCAGCAGGG - Intergenic
1174969175 20:55254671-55254693 AAGAAAGGCCAGATGAAGGGAGG - Intergenic
1175525012 20:59627675-59627697 ACTGAATCACAGATGCAGGTGGG - Intronic
1175716215 20:61255378-61255400 ACGAAAACACACATGCAGGAGGG + Intronic
1176112962 20:63418832-63418854 AAGCATGCACGGATGCAGATAGG + Intronic
1177407624 21:20690801-20690823 AAGAAACCACACAGGCAGGAAGG + Intergenic
1177754128 21:25323629-25323651 AGGAAAGCACAGCTGCTGGAAGG + Intergenic
1179356491 21:40665181-40665203 AAGAAAACACAGAGGCAGGCTGG + Intronic
1179570744 21:42277496-42277518 GAGCAGGGACAGATGCAGGTGGG + Intronic
1179642593 21:42757198-42757220 GAGACAGTACAGATGTAGGTTGG - Intronic
1180917543 22:19499489-19499511 AAGACAACACAGGAGCAGGTTGG + Intronic
1181679990 22:24488236-24488258 AAGAAACAACAGATTCAGGTTGG + Intergenic
1182753660 22:32661201-32661223 AAGACAGCAGAGAAGCAGGTTGG - Intronic
1183401070 22:37605003-37605025 TGGAAAGCACAGAAGCAGGCTGG - Intergenic
1183842190 22:40508160-40508182 AATAAATCACAGATGCTGATAGG + Intronic
1184519868 22:44986933-44986955 GGGAAAGGGCAGATGCAGGTGGG + Intronic
949253388 3:2015265-2015287 AAGAAGGGAGAGATGCAGGCTGG + Intergenic
949446240 3:4136964-4136986 AAGAAACAACAGATGCCGGAGGG + Intronic
950131604 3:10551007-10551029 CAGACAGCACTGAGGCAGGTGGG + Intronic
950900145 3:16490298-16490320 AAGAAGGAACAAATCCAGGTGGG + Intronic
952230829 3:31428962-31428984 AACAAACCACAGATCCAGGAAGG - Intergenic
953360377 3:42290581-42290603 GAGAAAGGACAGATGCAGGCAGG - Intergenic
954008259 3:47610750-47610772 AAGAGAGCACATAGGAAGGTTGG - Intronic
954618071 3:51980420-51980442 AGGCAAGCACAGAGGCAGGGCGG + Exonic
955342312 3:58134544-58134566 AAGAAAAGTCAGATGCAGCTGGG + Intronic
955447485 3:59029537-59029559 GAGGAAGCAAAGAAGCAGGTTGG + Intronic
957622471 3:82611750-82611772 AGGAAACAACAGATGCTGGTGGG - Intergenic
958458701 3:94366354-94366376 AAGAAACAACAGATGCTGGCAGG - Intergenic
959679170 3:109073135-109073157 CAGAAAGCACAGCCACAGGTAGG - Intronic
962000937 3:131296389-131296411 AAGAAAGAATCGATGAAGGTAGG - Intronic
962002647 3:131315227-131315249 AAGCATACACAGTTGCAGGTAGG - Intronic
963083699 3:141417569-141417591 AAGAAGGCAAAGAGACAGGTGGG - Intronic
963139764 3:141937739-141937761 AAGATAACACAGAAGCAGATGGG - Intergenic
964326799 3:155555694-155555716 AAGAAAAGACACATGGAGGTGGG - Intronic
964492861 3:157255552-157255574 AAGATAGCAGAGATGGAGGCAGG - Intergenic
964607818 3:158576631-158576653 TAGAAAGCTCAGAAGCAGGCTGG + Intronic
964713830 3:159700465-159700487 AAGAGAGTACAGATGTATGTAGG + Intronic
964824696 3:160812231-160812253 AAGAAAGAAAAGAGGAAGGTGGG - Intronic
965247376 3:166291323-166291345 AACAAAGTGCAGATGCAGGATGG - Intergenic
965361780 3:167749858-167749880 AAGAAAGCATAGGTGCCGGAAGG + Intronic
965760070 3:172066156-172066178 AAGACAGAACAGATGAAGTTTGG - Intronic
966142942 3:176776873-176776895 AAGAGAGAACAGATGTAGCTGGG - Intergenic
966985872 3:185179858-185179880 ATGTGAGCACAGATGCAGGGAGG + Intergenic
967295699 3:187962707-187962729 ATGTGGGCACAGATGCAGGTGGG + Intergenic
967350703 3:188511121-188511143 AAGAAAGGAGGGAAGCAGGTAGG - Intronic
967398101 3:189029431-189029453 AAGACAGCACAGAGACAGGTTGG - Intronic
967670831 3:192233202-192233224 AAAAAATAACAGATGCTGGTGGG - Intronic
968279886 3:197468439-197468461 AAGAAAATAAAGATGCAGCTGGG + Intergenic
969157125 4:5220769-5220791 CAGAAAGAACAGAGGCAGGGAGG + Intronic
969157358 4:5223109-5223131 AAGAAGGCCCAGGTGCAGCTTGG + Intronic
969166457 4:5320033-5320055 AGGAAAGCACACTTGCAGGAGGG + Intronic
969530056 4:7725564-7725586 TAGAAGTCACAGAGGCAGGTAGG + Intronic
969851627 4:9962059-9962081 AAGAAACAACAGATGCTGATGGG + Intronic
970547613 4:17145733-17145755 AGGAAACCACAGAAGCAGGAAGG - Intergenic
971402930 4:26293336-26293358 AAGACAGCACAGAGTCAGCTTGG + Intronic
972057243 4:34818719-34818741 AAAAAACAACAGATGCTGGTGGG + Intergenic
972158888 4:36198648-36198670 AAGAGTGCACAGATCCAGATGGG + Intronic
973284303 4:48398160-48398182 AAGAAACAACAGATGCTGGCTGG - Intronic
975611049 4:76203707-76203729 ATGAAGGAACAGATGCAGGCTGG + Intronic
975803686 4:78090102-78090124 AAGGAAGCACAGGTTTAGGTGGG - Intronic
977424716 4:96853194-96853216 AAGAAAGGACCAATGCAGGGAGG + Intergenic
978681752 4:111389222-111389244 AAGAGAGAACATATGCAGATAGG - Intergenic
978917703 4:114147010-114147032 AAGAAAACCCAGTTGCTGGTTGG + Intergenic
979768026 4:124486480-124486502 AAGAAAACACAAATGCAGTCTGG + Intergenic
980623815 4:135345251-135345273 AGGAAAGCACATATGGACGTTGG - Intergenic
980999478 4:139814759-139814781 CACAAAGCTCAGATGCAGGTAGG - Intronic
981144216 4:141306008-141306030 AAGAAAGGACAGAGGGAGTTTGG + Intergenic
981723410 4:147824021-147824043 AAAAAAACACAGATTCAGGCTGG + Intronic
981766122 4:148252029-148252051 AAGAAGGAAGAGATGCAGTTGGG - Intronic
981849522 4:149213107-149213129 AAGAAAGCACAGAAAGATGTAGG + Intergenic
982646607 4:158031844-158031866 AAAAAATAACAGATGCTGGTAGG + Intergenic
982754638 4:159203711-159203733 CAGAAAGCAAAGCTGTAGGTTGG + Intronic
984078182 4:175209106-175209128 AAGAAACAGCAGATGCAGGAAGG - Intergenic
984602598 4:181745606-181745628 AAGTAAGCACAAATGCAGAAAGG + Intergenic
985102005 4:186467560-186467582 AAAGAAGGACAGAGGCAGGTTGG + Intronic
985655779 5:1130752-1130774 AACCCAGCACAGACGCAGGTGGG + Intergenic
986914970 5:12608311-12608333 AAGAAACAACAGATGCTGGCAGG - Intergenic
986917549 5:12640809-12640831 AGGAAAGCACTCATTCAGGTGGG - Intergenic
987686642 5:21212890-21212912 GAGAAAGAAGAGATGAAGGTAGG + Intergenic
988076191 5:26358400-26358422 AAGAAACAACATATGCTGGTGGG - Intergenic
988514906 5:31895839-31895861 AAGAAAGGACAGAGGCAGGGTGG - Intronic
989397277 5:40971234-40971256 TGGAAAGAACAGATGCTGGTGGG - Intronic
989406851 5:41070912-41070934 AAAAAATCAAAGAGGCAGGTTGG + Exonic
989604475 5:43230730-43230752 AAGAAAGAACAGATGAAGGGGGG + Intronic
989672161 5:43931421-43931443 AAGAAACAACAGATGCTGGCAGG - Intergenic
991230067 5:64322486-64322508 AAGAAACAATAGATGCTGGTGGG + Intronic
991444152 5:66681764-66681786 AAGACAGCAGAGATACAGGTGGG - Intronic
991513576 5:67408213-67408235 AAAAAACCACTGATGCAGTTTGG - Intergenic
992091671 5:73323093-73323115 AAGAAAACACAATTGCAGGTTGG + Intergenic
992184000 5:74225932-74225954 AAGAAGGCACAGAGGAAGGGAGG - Intergenic
992919804 5:81503157-81503179 AAAAAACAACAGATGCAGCTGGG + Intronic
993127357 5:83851583-83851605 AAGAAAAACCAGATGCAGGCCGG - Intergenic
993556670 5:89348104-89348126 AAAAAATAACAGATGCTGGTGGG + Intergenic
994056122 5:95417989-95418011 GTGAAACCACAGATGAAGGTGGG - Intronic
995288413 5:110419193-110419215 AAGAAAGCAAAGATGGAGGAAGG + Intronic
997051183 5:130382510-130382532 AAGAAGGATCAGATGCAGGAAGG + Intergenic
998251233 5:140554461-140554483 AAGTGGCCACAGATGCAGGTGGG - Intronic
998635582 5:143951295-143951317 AGGAGAGCACAATTGCAGGTTGG + Intergenic
1000382183 5:160639070-160639092 CACAAAGCACAGAGGCAGGAAGG - Intronic
1002209054 5:177585122-177585144 AAGAAAGCAAGGATGAAGGAGGG + Intergenic
1003601942 6:7525880-7525902 ACCAAAGCACAGAGGCAGGAAGG + Intergenic
1003641672 6:7880412-7880434 ACGGAAGCACAGTTGGAGGTGGG + Exonic
1004734434 6:18391253-18391275 AACAAAGCTCAGAAGCAGGAAGG - Intronic
1005179529 6:23088869-23088891 AAGAAAGTGAAGATGCACGTGGG - Intergenic
1005444659 6:25909528-25909550 AAGAAAGCACACATGCAATTGGG + Intergenic
1005815562 6:29549286-29549308 ATGTGAGCACAGATGCAAGTAGG + Intergenic
1006395447 6:33784079-33784101 AAGGAAGAACAGCTGCAGGAAGG + Intronic
1007194038 6:40044485-40044507 AAGAAACCACAGATGCTGGTTGG + Intergenic
1007318887 6:41012031-41012053 AAGAAAGGAGAGATGGAGGTAGG + Intergenic
1007899705 6:45399702-45399724 AAGAAAGAAGAGAGGGAGGTAGG + Intronic
1008538770 6:52528365-52528387 AAGAAAGGAAAGAGACAGGTGGG - Intronic
1008731222 6:54484941-54484963 AAGAAAGAACTGGTTCAGGTTGG + Intergenic
1009377701 6:62992082-62992104 ATGAAAGGTGAGATGCAGGTGGG + Intergenic
1010084681 6:71903176-71903198 AAGAAACAACAGATGCTGGTGGG - Intronic
1010562398 6:77366919-77366941 AAGAAGTCACAGCTGAAGGTAGG + Intergenic
1010722550 6:79300274-79300296 GAGAAACAACAGATGCAGGAAGG - Intergenic
1010978106 6:82339397-82339419 AAGAAACAAAAGATGCAGGCTGG - Intergenic
1011370525 6:86632653-86632675 AAAAAACCACAGATGCTGGCAGG - Intergenic
1011552874 6:88546148-88546170 ATGAAAGCAGAGAGGCAGTTTGG + Intergenic
1011616813 6:89204855-89204877 AAGAAAATACAGATGCAGAATGG - Intronic
1012622290 6:101360500-101360522 AAGAAATCACAGATGAAGTATGG + Intergenic
1012980107 6:105820247-105820269 TAGAAAGCAGAGGAGCAGGTAGG + Intergenic
1014334882 6:120120802-120120824 AAAAAATAACAGATGCTGGTGGG - Intergenic
1014869444 6:126574110-126574132 AAGAAAGCACAAATTCAGAGTGG + Intergenic
1015449021 6:133342431-133342453 AAGGAAGCACAGATTCAGATCGG + Intronic
1016603380 6:145889348-145889370 AAAAAAGTAGAGATGGAGGTAGG + Intronic
1017265562 6:152441599-152441621 AAGGAAGCACAGAAGAAGGTAGG + Intronic
1017762165 6:157577845-157577867 AAAAAATAACAGATGCAGGCTGG - Intronic
1018302046 6:162413827-162413849 GAGAAAGCACAGACACAGGCAGG + Intronic
1018475638 6:164138162-164138184 AGGAATGCAGAGAAGCAGGTGGG - Intergenic
1018830564 6:167439734-167439756 AAGAAAACAGAGATACAGGGAGG + Intergenic
1019034501 6:169043058-169043080 AACAAAGCAGAGCTGCAGCTGGG - Intergenic
1019119478 6:169791894-169791916 AACAAAGAACACATACAGGTGGG - Intergenic
1020587561 7:10088191-10088213 AGGAAATCACAGAAGCAGGAAGG + Intergenic
1022124356 7:27341163-27341185 AAGTATGCACAGATCAAGGTTGG + Intergenic
1026871358 7:73854317-73854339 AAAAAAGCATAAATGCAGGCCGG - Intergenic
1027269366 7:76511627-76511649 AGGAGAGAACAGATGGAGGTGGG - Intronic
1027320077 7:77005520-77005542 AGGAGAGAACAGATGGAGGTGGG - Intergenic
1027516926 7:79153769-79153791 AAGCAAGGACAGATTCAGATGGG + Intronic
1027844916 7:83360796-83360818 AAGAAAGCACAGAGATAGGTGGG - Intergenic
1030413324 7:109210149-109210171 GAGAAACAACAGATGCTGGTGGG - Intergenic
1031162329 7:118183370-118183392 GAGAAAGGACCGATGCAGGAAGG - Intergenic
1032203169 7:129837709-129837731 AACAAAGAAAAGATGCAGGAGGG + Intronic
1032680760 7:134180350-134180372 TAGATAGAACAGATACAGGTAGG - Intronic
1033124759 7:138697980-138698002 AAGAAAGGACAGAGGAAGGGAGG + Intronic
1034069006 7:148164580-148164602 AAGAAAGCACAGAGTTAGGATGG - Intronic
1034658817 7:152751351-152751373 GAGCAGGCACAGATGCAGGGAGG - Intergenic
1034671697 7:152863707-152863729 AATAAAGCAGAGTTGCGGGTGGG - Intergenic
1035046262 7:155969276-155969298 CAGAAGGCACGGATGCAGGTGGG + Intergenic
1035330600 7:158094601-158094623 TAGAAAGCACAGATGGGGGCCGG - Intronic
1036134558 8:6148218-6148240 AAGAAACCACACATGAAGGAAGG + Intergenic
1036978777 8:13445131-13445153 AAGAGAGCACAGAGGGAGGAAGG + Intronic
1037096169 8:14990397-14990419 CTGAAAGTACAGATGCAGCTTGG - Intronic
1037128131 8:15374545-15374567 AAGAAAGCACAGGGAGAGGTGGG - Intergenic
1038056815 8:23866430-23866452 AGGAGAGAACAGATGTAGGTTGG + Intergenic
1040090880 8:43397337-43397359 AAAAAACAACAGATGCTGGTGGG - Intergenic
1042444791 8:68871347-68871369 CAGAAAACAAAGATGGAGGTAGG - Intergenic
1043493805 8:80778347-80778369 AAAAAATAACAGATGCTGGTTGG + Intronic
1044222328 8:89683844-89683866 AAGAAACAATAGATGCTGGTGGG + Intergenic
1044474762 8:92613282-92613304 AAGAAAACACCAGTGCAGGTGGG + Intergenic
1044508106 8:93044144-93044166 AAGAAACAACAGATGCTGATGGG - Intergenic
1044757994 8:95486477-95486499 ATAAAAGCACAGAGACAGGTAGG + Intergenic
1045487836 8:102646289-102646311 AAGACAGGACAGAGGCAGGGAGG + Intergenic
1045595940 8:103656769-103656791 AAGAAACCACAGATTCTGTTAGG + Intronic
1046669353 8:117041051-117041073 AGGAATGCACAGATGCATGCTGG + Intronic
1046707079 8:117466833-117466855 GAGAAAGCACAGAGGCAGTTGGG - Intergenic
1046735345 8:117770507-117770529 AAGAAAGCAAAGATGAAGGAAGG - Intergenic
1046988953 8:120427665-120427687 AAGAAACCAGAGATGAAGGCTGG + Intronic
1047166762 8:122447899-122447921 AAGAGAGCATAGACCCAGGTGGG + Intergenic
1047503845 8:125463347-125463369 AAGAAAGCACAGAAACAGATAGG - Intergenic
1049261558 8:141641746-141641768 CAGGAAGCACAGGGGCAGGTGGG + Intergenic
1049645684 8:143734638-143734660 GAGAAATCTCATATGCAGGTGGG - Intergenic
1050996945 9:12232496-12232518 AAGAAATCTCAGATGGAGATGGG - Intergenic
1052842638 9:33306080-33306102 AAAAAAGCACAGAGGCAGGGAGG + Intronic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053414432 9:37938141-37938163 GAGGCTGCACAGATGCAGGTAGG - Intronic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1053619210 9:39798816-39798838 AAGCATGCACACATGCAGCTGGG + Intergenic
1053877368 9:42558165-42558187 AAGCATGCACACATGCAGCTGGG + Intergenic
1053895295 9:42736523-42736545 AAGCATGCACACATGCAGCTGGG - Intergenic
1054234327 9:62543557-62543579 AAGCATGCACACATGCAGCTGGG - Intergenic
1054264947 9:62908613-62908635 AAGCATGCACACATGCAGCTGGG - Intergenic
1056047751 9:82736808-82736830 CAGAAAACCCAGAGGCAGGTGGG + Intergenic
1056191252 9:84186379-84186401 CAGAAAGTACATGTGCAGGTTGG - Intergenic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1058258570 9:102801826-102801848 AAGAAACAACAGATGCTGGAAGG + Intergenic
1058327048 9:103711357-103711379 AAAAAATAACAGATGCTGGTGGG - Intergenic
1058386090 9:104437502-104437524 AAGAAACAACAGATGCTGGGAGG - Intergenic
1058529890 9:105895073-105895095 AAGGAACAACAGATGCTGGTGGG - Intergenic
1058572816 9:106365816-106365838 AAGCAAGCCCAGGTGCAGGTTGG - Intergenic
1059812615 9:117872639-117872661 AAGAATGCACAGACGAATGTAGG + Intergenic
1059973754 9:119694276-119694298 CAGAGAGCAGAGATGCAGGGTGG - Intergenic
1060154662 9:121310924-121310946 ACAAATGCATAGATGCAGGTGGG + Intronic
1060669296 9:125454887-125454909 AGGAAAGCACAGATGTTGGCTGG + Intronic
1061635210 9:131903581-131903603 AAGAAAGCCCAGGTGCATGTGGG - Intronic
1061931708 9:133836231-133836253 CAGAAAGCACAGGAGCACGTGGG + Intronic
1062494765 9:136826530-136826552 AACAAAGCACAGGTGGAGGGAGG - Intronic
1062631970 9:137467126-137467148 GAGAAGGCACAGATGCAGGTTGG - Intronic
1187285088 X:17897428-17897450 GGGAAGGCACAGTTGCAGGTAGG - Intergenic
1188324412 X:28783256-28783278 AATAAGGCACAGATGCATTTTGG + Intronic
1188713037 X:33425436-33425458 AAAAAATAACAGATGCTGGTGGG - Intergenic
1188867492 X:35331516-35331538 GAGAAAGCACAGACACAGGATGG - Intergenic
1189508268 X:41635080-41635102 TAGACAGCACAGATGTAGCTTGG - Intronic
1190017004 X:46836012-46836034 AAGAAAACACAGAAGCAGCCTGG + Intergenic
1191108198 X:56785392-56785414 ATGGAAGCACAGATGAAGATGGG - Intergenic
1191220060 X:57978319-57978341 AATAAAGCACAGAAGCATCTGGG - Intergenic
1191701771 X:64049736-64049758 AAGAAACAACAGATGCTGGTGGG + Intergenic
1191944697 X:66519381-66519403 AAAAAATAACAGATGCTGGTGGG - Intergenic
1192202941 X:69078425-69078447 AAGAAAGAAGAGAAGGAGGTGGG - Intergenic
1193159249 X:78209432-78209454 AAGAAACAACAGATGCTGCTAGG + Intergenic
1193247099 X:79242180-79242202 AAATAAACACAAATGCAGGTGGG - Intergenic
1193481432 X:82033271-82033293 AAGAAAACCCAGTTGCTGGTGGG - Intergenic
1194437012 X:93879185-93879207 AAGAAACAACAGATGCTGGCGGG + Intergenic
1194579011 X:95648200-95648222 AACAAACCAGAGATTCAGGTGGG + Intergenic
1194995357 X:100586345-100586367 AAAAAAGCACAAATCCAGGAAGG + Intronic
1195125235 X:101802407-101802429 AGGAAAGCACATATGATGGTAGG - Intergenic
1195605649 X:106802999-106803021 AACACAGCCCAGAGGCAGGTAGG - Intronic
1195652855 X:107303916-107303938 CAGAAACCACAGATGCTGGAAGG + Intergenic
1195972064 X:110483786-110483808 AAGAAAGAACAGATGCTGGAGGG + Intergenic
1196437139 X:115684842-115684864 AAGATTGCACAACTGCAGGTAGG - Intergenic
1196554497 X:117070747-117070769 ACGCAAGCACAGTTGCTGGTTGG + Intergenic
1196976772 X:121166963-121166985 AAGTAAGCACTGATCCAGGTGGG - Intergenic
1197107220 X:122731233-122731255 AAAAAATAACAGATGCTGGTAGG + Intergenic
1197223990 X:123938717-123938739 AAGAAGGGAAAGAAGCAGGTTGG + Intergenic
1197891886 X:131277120-131277142 AATAAAGCTCATATGCTGGTGGG + Exonic
1198538722 X:137613404-137613426 AAGAAAGCATAAATGTGGGTTGG + Intergenic
1198895897 X:141454245-141454267 AAAAAACAACAGATGCTGGTGGG + Intergenic
1201575822 Y:15460597-15460619 AAAATAGCACATATGAAGGTAGG + Intergenic
1201909641 Y:19121023-19121045 AAGATGGCACAAATGCAGTTGGG + Intergenic