ID: 901568623

View in Genome Browser
Species Human (GRCh38)
Location 1:10140749-10140771
Sequence AGTATCTTCTAGGACATAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 160}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901568621_901568623 13 Left 901568621 1:10140713-10140735 CCTCATCTGTGTATTTTTCAATG 0: 1
1: 0
2: 0
3: 41
4: 488
Right 901568623 1:10140749-10140771 AGTATCTTCTAGGACATAGTTGG 0: 1
1: 0
2: 1
3: 13
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901568623 Original CRISPR AGTATCTTCTAGGACATAGT TGG Intronic
901568623 1:10140749-10140771 AGTATCTTCTAGGACATAGTTGG + Intronic
902947283 1:19850815-19850837 AGTCTCTCCTAAGACAGAGTGGG - Intergenic
906921436 1:50068660-50068682 TGGATATTCTAGGATATAGTAGG + Intronic
906971548 1:50519777-50519799 AGTATCTTCTAGAAGAAAGAAGG - Intronic
910023649 1:82623211-82623233 AGTCTCTCCTAAGACAGAGTTGG + Intergenic
911689214 1:100812722-100812744 AGTATCATCTAATACATAGCTGG + Intergenic
911806692 1:102219044-102219066 AGTGTTTTCTAGGAGACAGTGGG + Intergenic
916717435 1:167457081-167457103 AGAATCTTCTAAGACACTGTGGG - Intronic
917271431 1:173279106-173279128 AGTTTCCCCTAGGACATTGTAGG + Intergenic
919812203 1:201415972-201415994 AGTATCTTCTGGGCCATAGGCGG + Intronic
921076960 1:211707515-211707537 AGTCTCTCCTAAGACAGAGTGGG + Intergenic
921366621 1:214380509-214380531 AGTATCTTCAAGGAAGCAGTAGG + Intronic
923852372 1:237811127-237811149 ATTATCTTCTATAACATGGTGGG - Intronic
924522384 1:244816383-244816405 AGTCTCTCCTAAGACAGAGTGGG + Intergenic
1065331226 10:24602636-24602658 AGGGTCTTCTAGGCCATGGTAGG + Intronic
1065602434 10:27383317-27383339 AATATCTTCCAGCACACAGTGGG + Intergenic
1065636494 10:27741379-27741401 AGTATCTTCTCGGTCTTGGTGGG + Exonic
1066074656 10:31861116-31861138 AGTATGTTCTAAGACATAAGGGG + Intronic
1066933168 10:41792673-41792695 AGAATCTGCTAGGAGATATTTGG + Intergenic
1069731306 10:70616583-70616605 AGAATAATCTAGCACATAGTAGG - Intergenic
1070251392 10:74776493-74776515 AGTCTCTCCTAAGACAGAGTGGG + Intergenic
1074216994 10:111394813-111394835 AGTGGTGTCTAGGACATAGTAGG - Intergenic
1074451183 10:113561090-113561112 AGTGTCTTCTAGGATAAAGTTGG + Intronic
1077859236 11:6160368-6160390 AGTCTCTCCTAAGACAGAGTAGG - Intergenic
1078865034 11:15289331-15289353 AGTCTCTTCCAGGACAAAGCAGG - Intergenic
1080575786 11:33597863-33597885 TGTGTTGTCTAGGACATAGTAGG - Intronic
1081182758 11:40004487-40004509 GGTGTCTACAAGGACATAGTAGG + Intergenic
1081718223 11:45266820-45266842 AGTATCTGCTAGGACACAATTGG - Intronic
1082867195 11:57910913-57910935 AGTCTCTCCTAAGACAGAGTGGG - Intergenic
1083759592 11:64808287-64808309 GGTATCTTGTTGGACATAGAGGG - Intronic
1084878856 11:72155234-72155256 AGTCTCTCCTAAGACAGAGTGGG - Intergenic
1085834693 11:79940093-79940115 TGTAACTTCTGGCACATAGTAGG + Intergenic
1085983349 11:81752011-81752033 AATATTTTCTAGTACAAAGTGGG - Intergenic
1087070797 11:94078373-94078395 AGTATATGTTAGTACATAGTAGG - Intronic
1088205011 11:107382571-107382593 ATTATGTTCTAGAACATAATAGG - Intronic
1089009681 11:115122296-115122318 AATAGCGTCTAGCACATAGTGGG + Intergenic
1096747081 12:53736029-53736051 AACATCTCCTAGGACCTAGTGGG - Intergenic
1099831639 12:87851233-87851255 AGGAACTTCTGGGACATATTAGG - Intergenic
1101201628 12:102442321-102442343 AGTATCTTCTAAGAGAAACTTGG + Intronic
1102843098 12:116147011-116147033 AGTACCTTCTTAGGCATAGTAGG - Intronic
1105778267 13:23682565-23682587 AGTCTCTCCTAAGACAGAGTGGG + Intergenic
1108191100 13:47939918-47939940 AGTAGCTGCTAGGACAGAGGTGG - Intronic
1111218277 13:85173056-85173078 ATTATTTTCCAGGACAAAGTCGG - Intergenic
1111349207 13:87004117-87004139 AGACTGTTCTAGCACATAGTGGG - Intergenic
1113523881 13:110958865-110958887 AGTCTCTCCTAAGACAGAGTGGG + Intergenic
1115163840 14:30426043-30426065 AGGAACTTCTGGGACATAGCTGG + Intergenic
1118547772 14:66912787-66912809 AGTATAATCTAGTACATAATAGG - Intronic
1122174308 14:99905859-99905881 AGTCTCTCCTAAGACAGAGTGGG - Intronic
1126323538 15:47450306-47450328 AGTATCATCTAGCACATCATAGG - Intronic
1126575081 15:50188631-50188653 AGTAATGTCTAGCACATAGTAGG + Intronic
1131339018 15:91578913-91578935 AGGAGCTTCTTGGTCATAGTAGG - Intergenic
1133539861 16:6739570-6739592 AATATCTTCTAGAAAATAGAAGG + Intronic
1134069382 16:11251344-11251366 AGCCTCTTCTATGACATAATAGG - Intronic
1137521785 16:49201179-49201201 AATAACATCTAGCACATAGTAGG + Intergenic
1137663770 16:50235505-50235527 AATATTGTCTAGGACAGAGTAGG - Intergenic
1139054223 16:63162282-63162304 AGTATCTTCTGGCACATAGTAGG + Intergenic
1139157616 16:64462985-64463007 AATATCATCTAGTACTTAGTTGG + Intergenic
1139247565 16:65460983-65461005 GGTATTTTCTAGCACATAGTAGG + Intergenic
1145474543 17:23589248-23589270 AGTATCTTCAAGTGCATATTTGG + Intergenic
1150996068 17:70318996-70319018 AGTGTTGTCTAGGACAAAGTAGG - Intergenic
1155276598 18:24193940-24193962 AGTATCTTTCAGAACATAGCAGG + Intronic
1155792656 18:29994059-29994081 AGTGTATTTTAGGAAATAGTTGG + Intergenic
1161205406 19:3038513-3038535 AGGACCCTTTAGGACATAGTGGG - Intronic
1164006303 19:21152677-21152699 AGTCTCTCCTAAGACACAGTGGG - Intronic
1164118812 19:22247184-22247206 AGTCTCTCCTAAGACATATTGGG + Intergenic
1164348755 19:27304414-27304436 AGAATCTTCAAGGAGATAGTTGG + Intergenic
1164350489 19:27331274-27331296 AGTATCTTCAAGTAGATATTTGG - Intergenic
1164470081 19:28522817-28522839 AGTCTCTCCTAAGACAGAGTGGG + Intergenic
1166402826 19:42496146-42496168 AATACCTTCTAAGACATAGCGGG - Intergenic
926343852 2:11927618-11927640 AATATCTTCTAGGATTTGGTGGG - Intergenic
929420656 2:41786316-41786338 ATTATCTTATAGGGCAGAGTGGG - Intergenic
930151154 2:48061324-48061346 AGTCTCTCCTAAGACAGAGTGGG - Intergenic
931803191 2:65778595-65778617 AATCTTTTCTAGGTCATAGTTGG - Intergenic
933427424 2:82130261-82130283 AGTCTCTTCTAAGACAGAGTGGG + Intergenic
938658680 2:133463489-133463511 ATTATTTTCTAGCAAATAGTTGG + Intronic
939197432 2:138990352-138990374 AGTCTCTCCTAAGACAGAGTGGG + Intergenic
939530913 2:143360435-143360457 AGATTATTCTAGGACATTGTAGG + Intronic
939990534 2:148874492-148874514 TGTAGCATCTAGCACATAGTGGG - Intergenic
940093921 2:149952329-149952351 AGTATCCACTAGGGCCTAGTAGG - Intergenic
941339276 2:164286748-164286770 AGTAACTTCTAGGTCTCAGTTGG - Intergenic
942493512 2:176513865-176513887 AGTATATTCTAGTAAATACTAGG + Intergenic
947489733 2:230583261-230583283 AGTATCTTCTTTGACATTGTTGG + Intergenic
1170508278 20:17051411-17051433 AATATCATCTGGTACATAGTAGG - Intergenic
1171230050 20:23476904-23476926 AGTTTGTTCCAGGGCATAGTTGG + Intergenic
1171765318 20:29263629-29263651 AGTATCTGCTAGCAGATAATTGG + Intergenic
1174309751 20:49642781-49642803 CATATCTTATAGTACATAGTAGG + Intronic
1176321105 21:5326637-5326659 AGAATCTGCAAGGGCATAGTTGG - Intergenic
1177638746 21:23819220-23819242 AGTATCTTCTAACATATAATAGG + Intergenic
1178092042 21:29174213-29174235 AATATCTACAAGGACAGAGTTGG + Intronic
1178435961 21:32558671-32558693 AGTCTCTCCTAAGACAGAGTGGG - Intergenic
1178738338 21:35172646-35172668 TGTATCCTCTGGCACATAGTAGG - Intronic
1179353260 21:40633427-40633449 AGCAATTTCTAGGACATATTGGG - Intronic
1180243004 21:46524356-46524378 AGTTTCTCCTAAGACAGAGTGGG - Intronic
1184157888 22:42680571-42680593 AGGATCTTCCAGGGCAGAGTAGG + Intergenic
953061408 3:39431085-39431107 AGTATCTACCAGGAAAGAGTAGG + Intergenic
953153193 3:40343959-40343981 AGTCTCTCCTAAGACAGAGTGGG + Intergenic
958204137 3:90367549-90367571 AGTATCTTCAAGTAGATATTCGG - Intergenic
960571115 3:119186220-119186242 ATTATCTTCAAAGAAATAGTTGG - Intronic
963610751 3:147464880-147464902 AGTAACGACAAGGACATAGTTGG + Intronic
966147023 3:176823711-176823733 AGTCTCTCCTAAGACAGAGTGGG - Intergenic
966721148 3:183063946-183063968 AGTCTCTCCTAAGACAGAGTGGG + Intronic
966772415 3:183515756-183515778 AGCAGCTTCTAGGTCATACTTGG + Intronic
969420377 4:7090878-7090900 AGTCTCTCCTAAGACAGAGTGGG - Intergenic
971614468 4:28769908-28769930 AGTATACTCTTGGACATAATTGG + Intergenic
975043119 4:69769299-69769321 AGTGTCTCCTAAGACAGAGTGGG + Intronic
976347419 4:84020731-84020753 AGGATCTTCCAGGTCATAGGTGG - Intergenic
976643345 4:87362120-87362142 AGTCTCTCCTAAGACAGAGTGGG + Intronic
977405740 4:96596107-96596129 ATTATCTTCTAGTACATATATGG + Intergenic
977593135 4:98849032-98849054 AGTCTCTCCTAAGACAGAGTAGG - Intergenic
977674527 4:99732947-99732969 AGTCTCTCCTACGACAGAGTGGG - Intergenic
978757750 4:112322525-112322547 AATAACTCCTAGCACATAGTAGG - Intronic
980221665 4:129925130-129925152 AGTATCTTCAAGAACAAAATCGG - Intergenic
980479956 4:133375769-133375791 GGTATCTTCTAAAACATACTGGG - Intergenic
982578280 4:157145814-157145836 AGTCATTTCTAGGACAGAGTGGG + Intronic
982864002 4:160487953-160487975 AGTCTCTTCTAAGACAGAGAAGG + Intergenic
984441311 4:179774165-179774187 AGTCTCTCCTAAGACAGAGTGGG + Intergenic
987150777 5:15037417-15037439 AGTAGCTTTGAGGACATTGTTGG + Intergenic
988334681 5:29891267-29891289 ATTATCTTATAGTACATAGTAGG + Intergenic
991984147 5:72266039-72266061 AGTATCTCATAGGACAGAGGAGG + Intronic
993306986 5:86286230-86286252 AGAATCTCATAGGACATGGTTGG - Intergenic
993377931 5:87171606-87171628 AGTACTTTCTAGGTCATAGTGGG - Intergenic
993667148 5:90713408-90713430 ATTTTCTTGTAGAACATAGTGGG + Intronic
994129666 5:96211485-96211507 AGTATATTCCATGACAAAGTGGG - Intergenic
995109845 5:108417098-108417120 AGGAGCTTCTAGGTCATAGGTGG - Intergenic
996057991 5:119001376-119001398 AGTCTCTCCTAAGACAGAGTGGG - Intergenic
998300705 5:141016950-141016972 AGTCGGTTCTAGGACATAGGTGG + Intergenic
998678413 5:144436549-144436571 AATATTTTCTAGGAAGTAGTTGG - Intronic
1007353293 6:41291344-41291366 AGTCTCTCCTAAGACATAGTGGG - Intergenic
1008291530 6:49721870-49721892 AGTCTCTCCTAAGACAGAGTAGG - Intergenic
1010811043 6:80299179-80299201 AGTCTCTCCTAAGACAGAGTGGG - Intronic
1012748749 6:103129242-103129264 ATTTTCTTCTAATACATAGTAGG - Intergenic
1014200902 6:118607659-118607681 AGTCTCTCCTAAGACACAGTGGG - Intronic
1018077230 6:160228370-160228392 AGTCTCTTCTAAGACAGAGAGGG + Intronic
1018137957 6:160796406-160796428 AGTCTCTCCTAAGACAGAGTGGG + Intergenic
1018933675 6:168259401-168259423 AGTATTTTCAGGGACATGGTGGG + Intergenic
1024696432 7:51860961-51860983 AGTCTCTCTTAGGACACAGTGGG + Intergenic
1024824567 7:53376750-53376772 AAGATCTTCAAGGACAGAGTGGG - Intergenic
1025522799 7:61760803-61760825 AGTATCTACAAAGACATATTTGG - Intergenic
1025546552 7:62179830-62179852 AGTATCTACAAAGACATATTTGG - Intergenic
1025572247 7:62589056-62589078 AGAATCTGCTAGGAGATACTTGG - Intergenic
1027744454 7:82056123-82056145 AGTATCTTCTGGTTCATATTAGG - Intronic
1029481133 7:100813647-100813669 AGTATCTCATCGGACATGGTGGG - Exonic
1030609787 7:111676720-111676742 ATTATCATATAGAACATAGTTGG - Intergenic
1031516340 7:122703538-122703560 AGTATTTGCCAGCACATAGTAGG - Intronic
1032671830 7:134090899-134090921 AGTCTCTCCTAAGACAGAGTGGG - Intergenic
1034320425 7:150174953-150174975 AATATCTTCTAGGACTTAGATGG - Intergenic
1034772319 7:153792272-153792294 AATATCTTCTAGGACTTAGATGG + Intergenic
1039179555 8:34850160-34850182 AGTACCTTCTAGGACAGGTTAGG - Intergenic
1040132161 8:43809883-43809905 AGTATCTGCAAGGAGATATTTGG + Intergenic
1040141223 8:43917089-43917111 AGAATCTTCAAGTACATATTTGG + Intergenic
1041005005 8:53489081-53489103 AGTAGTCTCTAGCACATAGTAGG + Intergenic
1042129781 8:65576499-65576521 AGTATCTTCTTAGACACAGTGGG - Intergenic
1043014268 8:74919158-74919180 AATACCTTCTGGCACATAGTAGG + Intergenic
1043164113 8:76881998-76882020 AGTATATTCAATGACATAGAAGG - Intergenic
1044043381 8:87398801-87398823 AGTTTCTCCTAGGACTTATTGGG + Intronic
1044298619 8:90557152-90557174 ACCATCTTCTGGGATATAGTTGG + Intergenic
1044378593 8:91504826-91504848 AGTCTCTCCTAAGACAGAGTTGG - Intergenic
1048842981 8:138581312-138581334 AGAATCTTTTAGGTCACAGTTGG - Intergenic
1050317862 9:4421769-4421791 ACTAGCACCTAGGACATAGTTGG - Intergenic
1052520940 9:29547885-29547907 AGTCTCTCCTAAGACAGAGTAGG + Intergenic
1052891488 9:33704409-33704431 AGTCTCTCCTAAGACAGAGTGGG + Intergenic
1055896439 9:81181802-81181824 AGTCTCTAGTAGGACACAGTAGG + Intergenic
1056567552 9:87787905-87787927 AGTGTCATCTAGGACAGAGGTGG - Intergenic
1058806617 9:108598799-108598821 AGCATGTGCTAGCACATAGTAGG - Intergenic
1059206802 9:112474803-112474825 ACTATCTACTTGGAGATAGTGGG - Intronic
1060681372 9:125568074-125568096 AGTCTCTCCTAAGACAGAGTGGG + Intronic
1061818713 9:133210795-133210817 AGTATCTAAAAGGACACAGTTGG - Intergenic
1187354755 X:18557458-18557480 AGTATCTACGAGGATATAGAGGG - Intronic
1189774273 X:44456100-44456122 AGTATATTTTAGGATATAATAGG - Intergenic
1190485212 X:50917039-50917061 AGTAGTTTCCAGGACATAGGAGG - Intergenic
1190815284 X:53924064-53924086 AGTCTCTCCTAAGACAGAGTGGG + Intergenic
1190947384 X:55109164-55109186 AGTCTCTCCTAAGACAGAGTGGG + Intronic
1191564551 X:62508841-62508863 AGTATCTGCTAGTAGATATTTGG - Intergenic
1195607052 X:106817946-106817968 ACTTTGTTCTAGGAAATAGTAGG + Intronic
1201406538 Y:13655678-13655700 AGTCTCTCCTAAGACAGAGTGGG + Intergenic