ID: 901572806

View in Genome Browser
Species Human (GRCh38)
Location 1:10175263-10175285
Sequence ACAGATATGCAGTCTGTCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 202}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901572806 Original CRISPR ACAGATATGCAGTCTGTCCA TGG (reversed) Intronic
901507058 1:9691463-9691485 ACAGATAAGGAGTCAGGCCAGGG + Exonic
901572806 1:10175263-10175285 ACAGATATGCAGTCTGTCCATGG - Intronic
902963318 1:19979839-19979861 GCAGTTTTGCAGTCTTTCCATGG + Intronic
903094964 1:20963040-20963062 ACAAATATGCAATCTGGACATGG - Intronic
903111760 1:21141164-21141186 GCAGCAATGCAGTCTGCCCAAGG + Intronic
903812013 1:26039823-26039845 CCAGATATGCAGGCTGTGCAGGG + Exonic
904249626 1:29213748-29213770 ACTGTTAAGCAGTTTGTCCAAGG - Intronic
905256254 1:36687392-36687414 TCAGATTTTGAGTCTGTCCAGGG - Intergenic
907253131 1:53156561-53156583 ACAGTTCTGCAGGCTGTACAGGG - Intergenic
907831568 1:58069310-58069332 ACAGAGATTAAGTTTGTCCAAGG + Intronic
909032912 1:70562525-70562547 CCAGTCATGCAGTCTTTCCATGG - Intergenic
909988269 1:82189308-82189330 ACAGATCTGCAGGCTGACAATGG - Intergenic
910299033 1:85684488-85684510 ACAGATATACAGTGTATCTATGG + Intronic
913088569 1:115460561-115460583 AGAGTTAAGCAGTGTGTCCAAGG + Intergenic
916950675 1:169777206-169777228 ACAGATAGGCAGTACATCCATGG - Intronic
918244560 1:182647359-182647381 ACAGATGTGCATTCTAACCAGGG - Intronic
919413617 1:197278316-197278338 GTAGATATGGGGTCTGTCCAGGG - Intronic
920530337 1:206697406-206697428 ACAGTTCTGCAGGCTGTACAAGG + Intronic
921593011 1:217025417-217025439 AAAGAAATAAAGTCTGTCCAGGG + Intronic
921621549 1:217331141-217331163 ACAGTTCTGCAGGCTGTACAGGG + Intergenic
922093010 1:222415440-222415462 ACATATAAGCATTCTGACCACGG - Intergenic
923306833 1:232696330-232696352 AGTGATATGCAATCTCTCCAAGG - Intergenic
1063023958 10:2158932-2158954 ACAGTTCTGCAGGCTGTACATGG - Intergenic
1064326511 10:14356255-14356277 ACAGAGCTGCAGCCTGTCCCAGG + Intronic
1064469365 10:15619817-15619839 ACAGATATGGATTCAGGCCAGGG - Intronic
1065318455 10:24486600-24486622 ACACATATACACTCTGCCCAAGG - Intronic
1065495744 10:26325740-26325762 ACAGATTTGAACTCTGTGCAGGG + Intergenic
1069040366 10:63689856-63689878 AAAGTTAAGCAGCCTGTCCAAGG + Intergenic
1069184892 10:65410279-65410301 ACAGATATTACGTATGTCCATGG - Intergenic
1071094601 10:81958610-81958632 ACAGATATACAGGCTGGGCATGG + Intronic
1071864312 10:89709440-89709462 ACAGAAATTCAGTTTTTCCAAGG + Exonic
1075217883 10:120554638-120554660 ACAGTTCTGCAGGCTGTACAGGG + Intronic
1076341554 10:129750757-129750779 ACAGATATACAGTCATTCCTTGG - Intronic
1076482845 10:130796174-130796196 ACAGATATGAAGTCTCTGCAGGG - Intergenic
1077793018 11:5461635-5461657 ACAGAACTCCAGTCTGTGCAAGG - Intronic
1080646505 11:34191964-34191986 ACAGATACTCAGTGTGTCCTAGG + Intronic
1082677404 11:56122857-56122879 ACAGAAATGCAATCTGCTCATGG - Exonic
1083775080 11:64890627-64890649 ACCGACATGCAGTGTGGCCAAGG - Intergenic
1084666304 11:70578194-70578216 ACAGATACGGCGCCTGTCCAAGG + Intronic
1084916043 11:72429810-72429832 ACAGAAATGCAGTCTGTCCCCGG + Intronic
1085749240 11:79146194-79146216 ACAATTATGCAGTCTTTCCTGGG + Intronic
1088999844 11:115042689-115042711 ACAGATATGAAGTCTTAGCATGG - Intergenic
1091992979 12:4971873-4971895 ACAGTTCTGCAGGCTGTGCAAGG + Intergenic
1094408205 12:30141706-30141728 ACAAATCTGCAGGCTGTCCAGGG + Intergenic
1100443703 12:94641515-94641537 CCAGACATGCTGTCTCTCCATGG + Intronic
1100628146 12:96358302-96358324 ACAGATATGCAGATTATGCAGGG + Intronic
1101237579 12:102805036-102805058 ACAGAAATGGAGTCAGACCATGG + Intergenic
1102686126 12:114726148-114726170 ACAGATATGTAGGTTGCCCAAGG - Intergenic
1104942224 12:132400525-132400547 ACAGATCTGCAGTCTGGGCAGGG + Intergenic
1105663281 13:22523439-22523461 ACTGATATGCAGACTGTGGAAGG + Intergenic
1106456780 13:29934823-29934845 ACAGACATGCTGTCTGTGCTGGG - Intergenic
1106683312 13:32030931-32030953 CCAGAAATGCAGTCTTTTCAAGG - Intergenic
1108896589 13:55335754-55335776 ACAGTTCTGCAGGCTGTACAGGG - Intergenic
1116175098 14:41459220-41459242 ACAGATAAGCAGTCTTTGCTTGG - Intergenic
1119487933 14:75003899-75003921 ACAGATCTGTAGTCTATCAAGGG - Intronic
1121963934 14:98287253-98287275 ACAGATATTCAGTGTGTGTAAGG + Intergenic
1122304907 14:100757863-100757885 ACAGATTTGGTGTCTGTCAAGGG - Intergenic
1126408144 15:48344154-48344176 AGAGATTTGGAGTATGTCCATGG + Intergenic
1127777627 15:62278996-62279018 ACACATTTGCAATTTGTCCAGGG + Intergenic
1128144217 15:65323404-65323426 ACAAATATGCAGTCTGGGCAGGG - Intergenic
1128315287 15:66655855-66655877 ACAGAAATCCTGTCTCTCCAGGG + Intronic
1129071150 15:72952671-72952693 ACAGATGTGCAGCTTCTCCAGGG - Intergenic
1129087751 15:73114121-73114143 TCAGAAATGCTGTCTGTCCCAGG - Intronic
1129433138 15:75515963-75515985 AGAGATATGCAGTATGTTTATGG + Intronic
1130433174 15:83869554-83869576 CCTGTTATGCAGTCTGTCCAGGG + Intronic
1130880120 15:88047748-88047770 ACAGATAAACAGACTGTCCAGGG - Intronic
1133581461 16:7148542-7148564 ACAGCTATGTTGTCTGTTCAGGG - Intronic
1134064119 16:11216026-11216048 ACAGTTCTGCAGGCTGTACAGGG - Intergenic
1139084734 16:63570980-63571002 AGAGATAACCAGTGTGTCCATGG - Intergenic
1144392482 17:14807703-14807725 ACAGATATGCTCTGTGTCTAGGG - Intergenic
1149076531 17:52602066-52602088 CCTGCTATGCAGCCTGTCCATGG + Intergenic
1149337440 17:55650468-55650490 ACAGTTCTGCAGGCTGTACAGGG - Intergenic
1150415236 17:64982617-64982639 ACAGCTATGCAGTAGGCCCATGG - Intergenic
1150796385 17:68241078-68241100 ACAGCTATGCAGTAGGCCCATGG + Intergenic
1150832762 17:68539144-68539166 TCATATATGCAGTCTGTCATTGG + Intronic
1151293611 17:73167435-73167457 ACTGATCTGCAGTCTTTCCAAGG + Intronic
1153697947 18:7663557-7663579 ACAGATCTGCAGTCTGGGCAGGG + Intronic
1154292412 18:13121339-13121361 ACAAATATGCACTTTTTCCAAGG + Intronic
1154385466 18:13888249-13888271 ACAGATACACAGTGTGCCCATGG + Intronic
1155326395 18:24669237-24669259 GCAGATGTCCAGTCTGTCAAGGG + Intergenic
1157653499 18:49361611-49361633 ACAGATATTCAGTGTGTCTGGGG + Intronic
1162517311 19:11156277-11156299 AGAGAGGTGAAGTCTGTCCAGGG - Intergenic
1162953706 19:14086865-14086887 ACAGAGATGCTGTCTGCCCCGGG - Intergenic
1163187482 19:15649230-15649252 ACATTTCTGCAGACTGTCCAAGG - Exonic
1163221502 19:15924790-15924812 ACATTTCTGCAGACTGTCCAAGG + Exonic
1166929098 19:46290441-46290463 ACAGATCTGCAATCTGGGCAGGG - Intergenic
1168136370 19:54355034-54355056 ACTGAGAAACAGTCTGTCCAAGG + Exonic
1168665333 19:58200847-58200869 ACAGTTCTGCAGGCTGTACAAGG + Intronic
925952462 2:8927906-8927928 ACAGTTCTGCAGCCTGTACAGGG + Intronic
930183935 2:48392533-48392555 ACAGATAAACACTGTGTCCATGG + Intergenic
930915891 2:56687193-56687215 ATAGATATGCCCTCTGTTCAAGG + Intergenic
933077434 2:77946895-77946917 ACATCAATGCAGTCTGTACAAGG - Intergenic
934113194 2:88761114-88761136 ACAGATATGCATGCTGTTTATGG - Intergenic
935841011 2:107110511-107110533 ACAGTTCTGCAGGCTGTACAGGG + Intergenic
937100011 2:119261378-119261400 ACACATATGCATTTTCTCCAAGG - Intronic
939374986 2:141353209-141353231 AGTGATATGCAGTATTTCCAAGG + Intronic
940554239 2:155203041-155203063 CCAAATTTGCAGTCTGTCAAAGG + Intergenic
941466279 2:165831358-165831380 TAAGAGATGCAGTCTGTCAAAGG + Intergenic
943428920 2:187773279-187773301 ACAGATATTAACACTGTCCATGG - Intergenic
944312904 2:198254577-198254599 ACTGATATGCTGTCTGTGCCAGG - Intronic
945618884 2:212108480-212108502 AAAGATAAGCAGTGTGTTCAGGG + Intronic
946118472 2:217486274-217486296 GCAGTTATGGAGTCTGTCTAGGG + Intronic
946263834 2:218521172-218521194 ACAGTTCTGCAGGCTGTACAGGG - Intronic
946410671 2:219513717-219513739 ACAGATATGCAAGCTGGCCAGGG + Intergenic
948130335 2:235596090-235596112 ACAGTGATGCCGTCTTTCCATGG + Intronic
1170122629 20:12927054-12927076 AGAGAAATGCAGTCTGTTCCAGG + Intergenic
1170505812 20:17024709-17024731 ACAATCATGCAGTCTCTCCAGGG + Intergenic
1171036448 20:21715876-21715898 ACAGAATTGCATTATGTCCAGGG - Exonic
1171202738 20:23255086-23255108 ACACACATGCTGCCTGTCCATGG + Intergenic
1173377428 20:42499256-42499278 ACACATATACAGACTGTACATGG - Intronic
1173463307 20:43261339-43261361 ACAGCTATGCTGTCAGTCCTGGG - Intergenic
1173486340 20:43443985-43444007 AAAGTTATGAAGTTTGTCCAGGG + Intergenic
1174548902 20:51346770-51346792 ACAAATATGCAGTCTGGGCAAGG + Intergenic
1175159703 20:56999055-56999077 AGAGATATGCAATATATCCATGG - Intergenic
1177419182 21:20833419-20833441 AAAGATATGTAGTTTGTCCAAGG + Intergenic
1178818265 21:35951413-35951435 GCAGATAGGCAGTGTCTCCAGGG - Intronic
1182271207 22:29154628-29154650 GCAGATCTGCAGTCTTACCACGG - Intronic
1183562023 22:38582686-38582708 ACAGAAATGCAGTTTGTCCTGGG + Intronic
949333395 3:2946998-2947020 ACAGAAATGCAGGCTGGCCAGGG - Intronic
950913732 3:16621478-16621500 GCAGATCTGCAGACTGTCCAGGG - Intronic
952195957 3:31075604-31075626 AGAGATAAGCAGTCTTTTCAGGG + Intergenic
953277316 3:41514962-41514984 ACAGATATGCTGGCTGTGCATGG + Intronic
954540214 3:51388665-51388687 ACAGATATGCAGCGTGAACAAGG - Intronic
954863527 3:53710043-53710065 TCACATATCCAGTCTGTACAGGG + Intronic
954995396 3:54876672-54876694 ACAGATAAGAAGTTTGCCCAGGG - Intronic
955596719 3:60598937-60598959 ACAGATGTGCTGTCTGCCAAGGG + Intronic
955702364 3:61694566-61694588 AGAGATATGCAGTTTTTCCATGG - Intronic
957048662 3:75395657-75395679 CAAGCAATGCAGTCTGTCCACGG + Intergenic
957663281 3:83189173-83189195 TCAGATATGCAGTGTTTCAAAGG - Intergenic
958553098 3:95641844-95641866 AGAAAGATGCAGTCTTTCCAGGG + Intergenic
960058797 3:113297573-113297595 TCAGATGTGCTGTCTTTCCATGG + Intronic
960337123 3:116431609-116431631 ACTGATATGCATTATATCCAGGG - Intronic
960431547 3:117574957-117574979 ACAGATATGCAGTCTATCTGGGG + Intergenic
961547978 3:127649225-127649247 ACAGCTCTGCAGCCTGTTCAAGG + Intronic
964587176 3:158318971-158318993 ACAGATATGTAGTCTAACCTTGG + Intronic
967123690 3:186406253-186406275 GCAGATATCGGGTCTGTCCATGG + Intergenic
967166404 3:186783636-186783658 ACAGGTATGCAGTCTGTTGGCGG + Exonic
967375748 3:188798580-188798602 AAAGAACTGCAGTATGTCCAGGG - Intronic
969145399 4:5119036-5119058 ACAGATATGTAGTATATCTATGG - Intronic
969655895 4:8498407-8498429 ACAGTTCTGCAGGCTGTCTAGGG + Intergenic
971732444 4:30402851-30402873 ACATAAATGCAGACTGTACATGG + Intergenic
973150733 4:46884345-46884367 AAGGAAATGCAGTCTGGCCATGG - Intronic
973274763 4:48294745-48294767 ATGGAAATGAAGTCTGTCCATGG + Intergenic
974336546 4:60553805-60553827 AGAGCTATGCAGTTTATCCAAGG + Intergenic
980770674 4:137368699-137368721 ACAAATCTGCAGTTTGGCCAGGG + Intergenic
981010911 4:139923806-139923828 ACAGATCTGCTGTTTGTCTAGGG + Intronic
981938134 4:150255773-150255795 ACAGACATCCAGTGTGTCCTGGG + Intronic
983565533 4:169147047-169147069 ACAGATGTACAGTCTATTCATGG + Intronic
983614349 4:169685286-169685308 ACATATATGAAGTATTTCCACGG + Intronic
984654661 4:182304908-182304930 ACAGTGATTCAGTCTGTCGAGGG + Intronic
986153946 5:5155242-5155264 ACAGATAGGAAGTCTGTTAAGGG + Intronic
986196332 5:5539545-5539567 ACACATCTGCAGTCTGTAAAAGG + Intergenic
988064039 5:26211745-26211767 ACACATATGCATTGTGGCCAGGG - Intergenic
992613226 5:78525517-78525539 ACATCTAAGCAGTCTGTACAGGG + Intronic
993240966 5:85384585-85384607 ACAGATATGAAGTGACTCCAAGG - Intergenic
994283843 5:97939275-97939297 ACAGTTATGTAGGCTGTACAAGG - Intergenic
995222720 5:109669000-109669022 ACAGTTATGCAGTCTCTACTTGG + Intergenic
995440585 5:112187921-112187943 AAAGATAAGCAGTTTGTCCAAGG - Intronic
996097350 5:119412968-119412990 ACAGGTATGGACTCTGTACAGGG + Intergenic
997599631 5:135130465-135130487 ACAGATTTGCTCTCTGCCCAGGG + Intronic
999189939 5:149739735-149739757 AAGAAAATGCAGTCTGTCCAGGG - Intronic
999866976 5:155711423-155711445 ATTGATCTGCTGTCTGTCCATGG + Intergenic
1000094824 5:157962476-157962498 ACAGATATGCAGTTTGAACTGGG + Intergenic
1002988130 6:2211069-2211091 ACAGTTATGCAGGCTGTACAGGG - Intronic
1007148932 6:39668131-39668153 ACAGTTCTGCAGGCTGTACAGGG - Intronic
1007200434 6:40103585-40103607 TCTGATATACAGTCTTTCCACGG - Intergenic
1007385010 6:41514564-41514586 AGAGATATGCAGTCTGTCATGGG - Intergenic
1008202982 6:48615314-48615336 AGAGATACGTAGTCTGTCTAAGG - Intergenic
1012359037 6:98353431-98353453 GTAGATATGCCGACTGTCCAAGG + Intergenic
1013422097 6:109976714-109976736 AAAGATATTCAGACTGTCCATGG - Intergenic
1013938443 6:115629599-115629621 ACTGATATGCAGTCTTTCAGAGG + Intergenic
1014072225 6:117195984-117196006 CCAAATATGCATTCTGACCAAGG + Intergenic
1014355750 6:120406942-120406964 ACAGATGAGCAGTCTATCAAGGG - Intergenic
1017779802 6:157707030-157707052 AGAGATAAGCAGTGTTTCCATGG + Intronic
1018300808 6:162400795-162400817 CCTGATATGCAGTCTCTTCAAGG - Intronic
1018650740 6:165989254-165989276 ACATCTGTGCCGTCTGTCCATGG - Intergenic
1019888941 7:3929850-3929872 ACAGTCATGCAGGCTGTTCATGG + Intronic
1020373824 7:7462566-7462588 ACAGAAATGCAGGCTGAGCACGG + Intronic
1020502865 7:8944948-8944970 ACAGTTCTGCAGGCTGTACAAGG + Intergenic
1021894929 7:25224202-25224224 GGAGTTATGCAGTATGTCCAGGG + Intergenic
1022182610 7:27936533-27936555 ACATCTATGCAGTCTCTCTAAGG + Intronic
1022321434 7:29291541-29291563 AAAGATATGAAATATGTCCATGG - Intronic
1022796893 7:33738932-33738954 AGAGCTATGTAGTCAGTCCAGGG - Intergenic
1024658130 7:51469241-51469263 AAAGAAAAGCAGTTTGTCCAAGG + Intergenic
1032287087 7:130547107-130547129 ACCCATATGCAGTCTTTGCAGGG - Intronic
1032777469 7:135128513-135128535 TTAGAAAAGCAGTCTGTCCAAGG + Intronic
1033430674 7:141286680-141286702 TCCTCTATGCAGTCTGTCCAGGG - Intronic
1035772032 8:2155426-2155448 AAAGAAAAGCAGTTTGTCCAAGG - Intronic
1036160988 8:6388374-6388396 CCAGATATTCAGTCTCTGCAGGG + Intergenic
1037294814 8:17388887-17388909 CCAATTATGCAGTCTGTCCTTGG - Intronic
1040871761 8:52107054-52107076 ACAGCTCTGCAGGCTGTACATGG + Intergenic
1040983576 8:53269697-53269719 ATAGAAATGCATTTTGTCCAAGG + Intergenic
1043466326 8:80511405-80511427 TCTGAAATGCAGTCTGTTCAAGG - Intronic
1043823934 8:84902152-84902174 ACAGTTCTGCAGGCTGTACAGGG + Intronic
1046347983 8:112961709-112961731 ATAGTTTTGCAGTCTGTTCACGG - Intronic
1046403733 8:113743752-113743774 ACAGATAAGTAAACTGTCCAGGG - Intergenic
1046482517 8:114840776-114840798 ACAAATATACAATCTTTCCAGGG + Intergenic
1047178947 8:122568849-122568871 TGTGATATGAAGTCTGTCCAGGG - Intergenic
1048569469 8:135639672-135639694 ACAGTTCTGCAGGCTGTACAGGG + Intronic
1049475805 8:142796447-142796469 ACACACATGCAGTCAGTCCCAGG - Intergenic
1049489806 8:142889826-142889848 ACAGTTCTGCAGGCTGTACAGGG + Intronic
1049492780 8:142913978-142914000 ACAGAGCTGCTGTGTGTCCAGGG + Intronic
1052040031 9:23727771-23727793 ACAGATGTTCAGTATTTCCATGG - Intronic
1052161072 9:25260466-25260488 GCACATATGCAGTCTGTATAAGG - Intergenic
1052439288 9:28473525-28473547 ACAGTAATGCAGTATGTCCCGGG - Intronic
1053715439 9:40884069-40884091 CAAGCAATGCAGTCTGTCCATGG + Intergenic
1055427866 9:76214749-76214771 AAATGTAAGCAGTCTGTCCAAGG - Intronic
1055933824 9:81586535-81586557 TCACATATGCGGTCTGTCCTTGG + Intronic
1056503231 9:87231461-87231483 ACTGATATGCAGTCTATCTGTGG - Intergenic
1057308192 9:93924736-93924758 ACTGATATGGAGTCTGGCCCAGG + Intergenic
1057971427 9:99561894-99561916 ACAGCTATGCAGCCTGGCCAAGG + Intergenic
1058261824 9:102842921-102842943 ACCGATTTGCAGTCTGTGCATGG + Intergenic
1059188199 9:112296662-112296684 ACAGATAGGCAGTGGGTCCCTGG - Intronic
1186884436 X:13899089-13899111 ACAGATATGCAGTGTATCTGGGG + Intronic
1187033524 X:15513177-15513199 AAAGATAGGCAGTCAGTCAAGGG + Intronic
1187147590 X:16651517-16651539 ACACAAATGAAGCCTGTCCAAGG - Intronic
1190474835 X:50815548-50815570 TCATATATGCAGACAGTCCAGGG - Intergenic
1191863216 X:65682931-65682953 ACAGATAAACAGTCTCTCCAAGG - Intronic
1193040435 X:76998694-76998716 CTAGAGAGGCAGTCTGTCCATGG + Intergenic
1193511602 X:82408057-82408079 TCAAATATGCAGTCTATCCTAGG + Intergenic
1193911600 X:87313494-87313516 ACAGTTCTGCAGGCTGTACAGGG + Intergenic
1194090875 X:89581069-89581091 ATAGCTATGCAGGGTGTCCATGG - Intergenic
1195070192 X:101271792-101271814 TCATATATGCAGTCTGTCATTGG + Intronic
1195766679 X:108303528-108303550 ACAGATATGCAGAGTGAGCATGG + Intronic
1198704304 X:139431112-139431134 ACAAATATACAGTATGTCTATGG - Intergenic
1199235369 X:145486887-145486909 ACAGTTTTGCAGGCTGTACAAGG + Intergenic
1199733417 X:150660689-150660711 ACAGTTCTGCAGGCTGTACAAGG + Intronic
1200443525 Y:3237132-3237154 ATAGCTATGCAGGGTGTCCATGG - Intergenic
1202584621 Y:26409665-26409687 CAAGCAATGCAGTCTGTCCACGG - Intergenic