ID: 901577167

View in Genome Browser
Species Human (GRCh38)
Location 1:10210460-10210482
Sequence GTCCGTCGCGGGCGCCGGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 140}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901577159_901577167 10 Left 901577159 1:10210427-10210449 CCGAGCTCTGTGCTGTGATTGGT 0: 1
1: 0
2: 3
3: 18
4: 256
Right 901577167 1:10210460-10210482 GTCCGTCGCGGGCGCCGGGGCGG 0: 1
1: 0
2: 1
3: 14
4: 140
901577157_901577167 11 Left 901577157 1:10210426-10210448 CCCGAGCTCTGTGCTGTGATTGG 0: 1
1: 0
2: 1
3: 22
4: 232
Right 901577167 1:10210460-10210482 GTCCGTCGCGGGCGCCGGGGCGG 0: 1
1: 0
2: 1
3: 14
4: 140
901577155_901577167 15 Left 901577155 1:10210422-10210444 CCGCCCCGAGCTCTGTGCTGTGA 0: 1
1: 0
2: 1
3: 15
4: 179
Right 901577167 1:10210460-10210482 GTCCGTCGCGGGCGCCGGGGCGG 0: 1
1: 0
2: 1
3: 14
4: 140
901577154_901577167 30 Left 901577154 1:10210407-10210429 CCTACGATTGGCTGGCCGCCCCG 0: 1
1: 0
2: 0
3: 2
4: 37
Right 901577167 1:10210460-10210482 GTCCGTCGCGGGCGCCGGGGCGG 0: 1
1: 0
2: 1
3: 14
4: 140
901577156_901577167 12 Left 901577156 1:10210425-10210447 CCCCGAGCTCTGTGCTGTGATTG 0: 1
1: 0
2: 0
3: 15
4: 179
Right 901577167 1:10210460-10210482 GTCCGTCGCGGGCGCCGGGGCGG 0: 1
1: 0
2: 1
3: 14
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901577167 Original CRISPR GTCCGTCGCGGGCGCCGGGG CGG Intergenic
900091899 1:924341-924363 TTGGGTCGCGGGGGCCGGGGAGG - Intergenic
901049415 1:6418948-6418970 GGCAGACGCGGGCGCTGGGGCGG + Exonic
901577167 1:10210460-10210482 GTCCGTCGCGGGCGCCGGGGCGG + Intergenic
901602082 1:10430422-10430444 GCCCGTCGCTCGCGCCGCGGCGG + Exonic
902629679 1:17697209-17697231 GGGCGTCGCGGGCGCAGGGCCGG - Exonic
903349989 1:22711413-22711435 GGCCGTGGCGGGGGGCGGGGGGG + Intronic
903986890 1:27234974-27234996 GCCCTCCGCGGGCGCCGAGGCGG + Intronic
904050211 1:27634294-27634316 GACCGCCGCGGGCGCGGAGGGGG + Intronic
904189979 1:28736406-28736428 GCCCCTCGCGGGGGCGGGGGCGG + Intergenic
906614569 1:47225571-47225593 GGCGGGCGCGGGGGCCGGGGCGG + Exonic
912492619 1:110070467-110070489 GTCAGCCGCGGGCCGCGGGGCGG + Exonic
913975370 1:143451019-143451041 GGCAGTCGCCGGCGCCGGGCTGG + Intergenic
916548368 1:165827763-165827785 GTCCGACGCGGGCGCGGGCGGGG + Exonic
916549866 1:165839926-165839948 GTCTGGGGCGGGGGCCGGGGTGG - Intronic
917846750 1:179026189-179026211 GTACGTAGCGCGCGCCGGGCTGG + Intronic
917954767 1:180083820-180083842 GTATGTGGCGGGCGGCGGGGAGG + Intronic
918487480 1:185045284-185045306 GACCGCGGTGGGCGCCGGGGGGG + Intergenic
1069769485 10:70888364-70888386 CTCTGTCGCTGGCGGCGGGGAGG - Intronic
1072141573 10:92593258-92593280 GTCCCTCTCGGGCGCTGGCGTGG - Intergenic
1074377741 10:112952595-112952617 GCCCGTCGTGGGCCCCAGGGGGG + Intronic
1076817064 10:132920257-132920279 GCCCTGCGCCGGCGCCGGGGTGG + Intronic
1077201474 11:1309562-1309584 CTCCGTCGCAGGCTCCGGCGGGG - Exonic
1077495476 11:2884839-2884861 GTCCGGGGCCGGGGCCGGGGCGG + Exonic
1077514242 11:2992152-2992174 GTCCGGCGCGGGCGCGGCGGCGG - Intronic
1077898787 11:6473908-6473930 GTCCGGCGGCGGCGCCGGCGCGG - Intronic
1089513848 11:119018986-119019008 GCCCGTGGCGGGTGCGGGGGTGG + Intronic
1090438662 11:126708564-126708586 TTCCGACGTGGGCTCCGGGGTGG + Intronic
1091778754 12:3200826-3200848 GTCGGGCGCGGGCTGCGGGGGGG - Intronic
1096466156 12:51848589-51848611 GTCCGGCCCGGGGACCGGGGCGG + Intergenic
1096495461 12:52037169-52037191 GGCGGCCGCGGGCGCGGGGGCGG + Intronic
1102997447 12:117361204-117361226 GGCGGCCGCGGGCGCCCGGGAGG - Intronic
1103547522 12:121712717-121712739 GGGCGGGGCGGGCGCCGGGGCGG + Intergenic
1112505216 13:99971043-99971065 GGCCGCCGCGGGGGCCGTGGCGG + Exonic
1116887039 14:50231640-50231662 GGCCGTAGCGGGAGTCGGGGCGG - Intergenic
1122066352 14:99176414-99176436 GTAAGTCGCTGGCGCCCGGGTGG - Intronic
1122558134 14:102592448-102592470 GTCCGTCCGGGGCGGCGGGGCGG - Intergenic
1202899773 14_GL000194v1_random:28353-28375 CGCCGGCGCAGGCGCCGGGGGGG - Intergenic
1129752773 15:78077545-78077567 GTCCGGCGCGGGAGCCAGCGCGG - Exonic
1132314355 15:100879604-100879626 GCGCGGCGCGGGCGCCGGGACGG + Exonic
1132658428 16:1051087-1051109 GTCCGTCGCTGGAGCAGGGGTGG + Intergenic
1135325047 16:21520685-21520707 GGATGACGCGGGCGCCGGGGGGG - Intergenic
1136336529 16:29613953-29613975 GGATGACGCGGGCGCCGGGGGGG - Intergenic
1139599939 16:67980392-67980414 GTCGGCCGCGGGAGCCTGGGAGG + Exonic
1141463341 16:84191364-84191386 ATACGTCGCGGGCGCGGGCGCGG - Exonic
1142005981 16:87689817-87689839 GGCGGGCGCGGGCGGCGGGGTGG - Exonic
1142412437 16:89923477-89923499 GCCTGTCCCGGGCCCCGGGGCGG + Intronic
1144500946 17:15786460-15786482 GTCAGCCGCAGGCGCCGGGCCGG - Intergenic
1146064165 17:29622264-29622286 GGCCGTGGCGGGGGCAGGGGTGG - Intronic
1146416238 17:32635684-32635706 CTCCGTCTCGGGTGGCGGGGGGG + Intronic
1147293407 17:39461757-39461779 CTCAGGCCCGGGCGCCGGGGAGG - Intronic
1148911349 17:50944716-50944738 GTTCGCAGCGGGCGGCGGGGAGG - Intergenic
1151296905 17:73192824-73192846 GGCGGGCGCGGGCGCGGGGGCGG - Intronic
1151498428 17:74473561-74473583 GACCGTGGCGGGCCCCGTGGGGG + Exonic
1151508635 17:74544900-74544922 GACCGTGGCGGGCCCCGTGGGGG - Exonic
1151876430 17:76870033-76870055 GTCCGGCCCCCGCGCCGGGGCGG - Intronic
1153285158 18:3450002-3450024 GTCCCTCGGGGGCGGCGGTGCGG - Intronic
1157609986 18:48950172-48950194 GCCAGCCGCGGGCGCCGGCGCGG - Exonic
1160100511 18:75916279-75916301 GTGCGCCGCGGGCTCCCGGGCGG - Intergenic
1160454847 18:78992959-78992981 CTGCGGCGCTGGCGCCGGGGCGG - Exonic
1160869253 19:1269529-1269551 GTCCCTCGCCGCCGGCGGGGCGG - Intronic
1163304848 19:16471698-16471720 GACCCTCGCGGGCACCGGCGAGG - Intronic
1163830637 19:19545649-19545671 GTCCTCCGCGGGCACCGGTGGGG - Exonic
1165461109 19:35944928-35944950 GAGCGCCGCGGGCTCCGGGGCGG - Exonic
1165946436 19:39445658-39445680 GGCAGTTCCGGGCGCCGGGGAGG + Intronic
1166882945 19:45940219-45940241 GGCCGGGGCGGGCGGCGGGGCGG - Exonic
1167466135 19:49651885-49651907 GGCGGGCGCGGGCGCCGGGGAGG - Exonic
1167509483 19:49888533-49888555 GTCCGTGGAGGGCGGCGGGGTGG - Exonic
1168242546 19:55094678-55094700 GTCCGCTGGGGGCGCCGTGGAGG + Exonic
927652426 2:24920410-24920432 ATCCGGCGCGGGCGGCGGGCTGG + Intergenic
933684917 2:85134457-85134479 GCCCGTCGGGCGCGCCGGGGAGG + Intronic
934163955 2:89277509-89277531 GTCTGTCGTGGGGGCGGGGGAGG + Intergenic
934203317 2:89905015-89905037 GTCTGTCGTGGGGGCGGGGGAGG - Intergenic
935396880 2:102619262-102619284 GTCCGACGCTGCCTCCGGGGCGG + Intergenic
936433269 2:112482244-112482266 GGCCGCGGCGGGCGCCCGGGCGG + Exonic
937045150 2:118847182-118847204 GGCCGGCGCGGCGGCCGGGGCGG - Exonic
941686962 2:168456817-168456839 TTTCCTCCCGGGCGCCGGGGAGG + Intronic
941804274 2:169694581-169694603 GAGCGTCACGGGCGCCGGGGCGG + Exonic
941805538 2:169708418-169708440 GTCCTTCGCGGGCCCTAGGGGGG + Intronic
943645890 2:190408059-190408081 GTCCCTCCGGGCCGCCGGGGCGG + Intergenic
948140832 2:235670677-235670699 GGCGGTCGCGGGCTCCAGGGTGG - Intronic
948823156 2:240560513-240560535 GTCCCCCGCGGGCGCTGGGCCGG - Exonic
948991676 2:241558863-241558885 GGACGGGGCGGGCGCCGGGGCGG + Exonic
948991692 2:241558961-241558983 GCATGGCGCGGGCGCCGGGGTGG - Exonic
949052717 2:241905745-241905767 GAGCGTCGAGGGCGCCAGGGTGG - Intergenic
1171376109 20:24695049-24695071 GTCCGGAGCCGGCGCCGGCGAGG - Intergenic
1173548170 20:43914875-43914897 GTCCATGGCGGGCGCGGCGGCGG - Exonic
1174246820 20:49188061-49188083 GGCCCTCGCGGGCGCCGCCGCGG - Intronic
1175429122 20:58890303-58890325 CGCCGTCGGGGGCGCCGAGGAGG + Intronic
1175743948 20:61440725-61440747 GCCCGTGGCGGGCGCCATGGAGG + Intronic
1176547816 21:8209067-8209089 GGCGGGCGCGGGCGCAGGGGTGG - Intergenic
1176574643 21:8436302-8436324 GGCGGGCGCGGGCGCAGGGGTGG - Intergenic
1176611256 21:8987594-8987616 GGCGGGCGCGGGCGCAGGGGTGG - Intergenic
1177043879 21:16145921-16145943 GTCCGTCGGGGGAGGTGGGGTGG + Intergenic
1180650237 22:17370362-17370384 GTCGGCCGCGGCCGGCGGGGAGG + Intronic
1181000883 22:19987266-19987288 GGGCGTGGCGGGGGCCGGGGTGG + Intronic
1181079710 22:20405747-20405769 GCGCGGGGCGGGCGCCGGGGAGG + Exonic
1184265553 22:43344006-43344028 GTCCGTCCCGGGCGCCCGCCCGG - Intergenic
1184580470 22:45413354-45413376 GTCTGCCGCGGGCGCCTGGCCGG - Intronic
1185315667 22:50178208-50178230 GTCAGGGGCGGGCGGCGGGGCGG - Exonic
1185397620 22:50600888-50600910 GCCCGGCCCGGGCGCCGAGGGGG - Intronic
1203252690 22_KI270733v1_random:125352-125374 GGCGGGCGCGGGCGCAGGGGTGG - Intergenic
1203260747 22_KI270733v1_random:170439-170461 GGCGGGCGCGGGCGCAGGGGTGG - Intergenic
950316346 3:12004742-12004764 CTGCGGCGCGGGCGCCGAGGCGG - Exonic
950465213 3:13149408-13149430 GTGTGTCGTGGGGGCCGGGGTGG + Intergenic
954632771 3:52056237-52056259 GTCCGGCGCAGGCACCGGGGCGG - Exonic
959085748 3:101849440-101849462 GGCCGGGCCGGGCGCCGGGGAGG + Intronic
967694403 3:192514851-192514873 GTCCATCGCGCGCGCCCAGGTGG + Intronic
967904130 3:194486892-194486914 CTACGTCGCTGGCGGCGGGGGGG - Intronic
968186961 3:196639634-196639656 GCGCGGCGCGGGCGCGGGGGTGG - Intergenic
968908010 4:3463436-3463458 GCGCGTCGGGGGCGCGGGGGGGG + Intronic
969240373 4:5893108-5893130 GGGCGTGGCGCGCGCCGGGGCGG + Intergenic
969829211 4:9781638-9781660 GGCAGTCGCGGGCGCCAGGCTGG - Intronic
975373933 4:73620456-73620478 GGCCCGCGCGGGCGCAGGGGCGG + Exonic
977667115 4:99654281-99654303 GTCCGTCTCTGGCCCCGGAGGGG + Exonic
981033821 4:140151496-140151518 GTGAGTCCCCGGCGCCGGGGTGG - Intronic
981528755 4:145733025-145733047 GACAGTCGCGGGGGCGGGGGCGG + Intronic
984995445 4:185426032-185426054 GTCCCTCGCGGACGGCGAGGCGG + Intergenic
985555303 5:555196-555218 CTTCCTCGCGGGCGCCGGGGCGG + Intergenic
989812616 5:45696007-45696029 GCCCGTCGCGGACGCCTTGGCGG + Exonic
992962676 5:81971877-81971899 GGTGGTCGCGGGCGGCGGGGAGG + Intergenic
995764676 5:115602361-115602383 GCCCCTCGGGGGCGGCGGGGTGG - Exonic
997883998 5:137614671-137614693 GTCTGCTGCGGGCGCAGGGGTGG - Intergenic
998134669 5:139668411-139668433 GACCCGGGCGGGCGCCGGGGCGG - Intronic
1002691459 5:181053318-181053340 TACCGGCGCGGGCGGCGGGGCGG + Intronic
1002888168 6:1313414-1313436 GGCGGGCGCGGGCGGCGGGGCGG - Exonic
1003049293 6:2765588-2765610 GGCCGCGCCGGGCGCCGGGGAGG + Exonic
1003569532 6:7246977-7246999 GTCGGCCCCGGGTGCCGGGGAGG + Exonic
1004044723 6:12012567-12012589 GTTCGGCGCGGGCTCCGCGGCGG + Intronic
1005334015 6:24775266-24775288 AACGGTCGCGGGAGCCGGGGCGG + Intronic
1007363214 6:41373197-41373219 CTCCGGCGCGGGGGCTGGGGCGG - Intergenic
1007363729 6:41375678-41375700 GCCCGGAGCGGGAGCCGGGGCGG + Intergenic
1007665353 6:43510142-43510164 GTCCCTCGCGGTCGCGGCGGCGG + Exonic
1014079554 6:117270918-117270940 GCCGGGCGCGGGCGCCGGGGCGG - Exonic
1022375555 7:29807575-29807597 GCCCGTGGCGGGCGCCGGGGCGG + Intronic
1024279894 7:47710294-47710316 GACAGTGGCGGGCGGCGGGGTGG - Intronic
1026968525 7:74454528-74454550 CGCGGTGGCGGGCGCCGGGGTGG + Intronic
1032298797 7:130668393-130668415 GGCGCGCGCGGGCGCCGGGGCGG + Intronic
1034197812 7:149261889-149261911 GTCCCACGCGGGAGCCGGGAGGG - Intergenic
1034951233 7:155298112-155298134 GTCCGCCGCTGGCCCCGGGCGGG + Intronic
1035082992 7:156233165-156233187 GTCTGTCGCGGGCGGCGGGCGGG + Intergenic
1038816683 8:30912090-30912112 CTCCGACGCGGGCGCCTGAGGGG - Intergenic
1041369430 8:57143364-57143386 ATCCGCCGCCGGGGCCGGGGTGG + Intergenic
1042962668 8:74320756-74320778 GGCGGGCGCGGGCGCGGGGGTGG + Intronic
1045432132 8:102124107-102124129 GTGCGCCGCGGGCGCAGGGGTGG - Intronic
1049570684 8:143369008-143369030 GGACGGCGCGGGCGCCGGCGAGG + Exonic
1050357084 9:4793327-4793349 GTCCGGCGAGCGCGTCGGGGAGG + Intronic
1052473756 9:28932157-28932179 GGCAGTGGCGGGGGCCGGGGGGG + Intergenic
1058053249 9:100427139-100427161 GTCCGTCGGCGCCGCCGAGGAGG - Intronic
1061828509 9:133275787-133275809 GCCCGGCGCGGGCGCCGGAGGGG - Intergenic
1062507704 9:136886570-136886592 GTCGGGCGCGGGCGCGGGGTCGG + Intronic
1062618133 9:137407287-137407309 GTTCGCCGCGGCCGCCGGGCTGG - Intronic
1203469094 Un_GL000220v1:108504-108526 GGCGGGCGCGGGCGCAGGGGTGG - Intergenic
1203476915 Un_GL000220v1:152476-152498 GGCGGGCGCGGGCGCAGGGGTGG - Intergenic
1190322653 X:49187765-49187787 GTCTTTTTCGGGCGCCGGGGAGG - Intergenic
1198480249 X:137034070-137034092 GTGCGTCACGGGCGCAGGCGGGG - Intergenic
1200277864 X:154751164-154751186 GGCCGCCGCGGCCCCCGGGGAGG + Intronic