ID: 901583436

View in Genome Browser
Species Human (GRCh38)
Location 1:10265442-10265464
Sequence CAGGAATTCGAGACCAACCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148718
Summary {0: 48, 1: 1384, 2: 17107, 3: 63559, 4: 66620}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901583436_901583441 17 Left 901583436 1:10265442-10265464 CCCAGGTTGGTCTCGAATTCCTG 0: 48
1: 1384
2: 17107
3: 63559
4: 66620
Right 901583441 1:10265482-10265504 CACCTTGACCTCCCAAAGAGTGG 0: 2
1: 6
2: 212
3: 779
4: 1702
901583436_901583444 19 Left 901583436 1:10265442-10265464 CCCAGGTTGGTCTCGAATTCCTG 0: 48
1: 1384
2: 17107
3: 63559
4: 66620
Right 901583444 1:10265484-10265506 CCTTGACCTCCCAAAGAGTGGGG 0: 1
1: 10
2: 614
3: 12329
4: 117312
901583436_901583442 18 Left 901583436 1:10265442-10265464 CCCAGGTTGGTCTCGAATTCCTG 0: 48
1: 1384
2: 17107
3: 63559
4: 66620
Right 901583442 1:10265483-10265505 ACCTTGACCTCCCAAAGAGTGGG 0: 2
1: 172
2: 4362
3: 45466
4: 151100
901583436_901583446 27 Left 901583436 1:10265442-10265464 CCCAGGTTGGTCTCGAATTCCTG 0: 48
1: 1384
2: 17107
3: 63559
4: 66620
Right 901583446 1:10265492-10265514 TCCCAAAGAGTGGGGATTCCAGG 0: 1
1: 5
2: 704
3: 28206
4: 338906

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901583436 Original CRISPR CAGGAATTCGAGACCAACCT GGG (reversed) Intronic
Too many off-targets to display for this crispr