ID: 901583437

View in Genome Browser
Species Human (GRCh38)
Location 1:10265443-10265465
Sequence TCAGGAATTCGAGACCAACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 533252
Summary {0: 71, 1: 4286, 2: 69888, 3: 232200, 4: 226807}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901583437_901583444 18 Left 901583437 1:10265443-10265465 CCAGGTTGGTCTCGAATTCCTGA 0: 71
1: 4286
2: 69888
3: 232200
4: 226807
Right 901583444 1:10265484-10265506 CCTTGACCTCCCAAAGAGTGGGG 0: 1
1: 10
2: 614
3: 12329
4: 117312
901583437_901583441 16 Left 901583437 1:10265443-10265465 CCAGGTTGGTCTCGAATTCCTGA 0: 71
1: 4286
2: 69888
3: 232200
4: 226807
Right 901583441 1:10265482-10265504 CACCTTGACCTCCCAAAGAGTGG 0: 2
1: 6
2: 212
3: 779
4: 1702
901583437_901583442 17 Left 901583437 1:10265443-10265465 CCAGGTTGGTCTCGAATTCCTGA 0: 71
1: 4286
2: 69888
3: 232200
4: 226807
Right 901583442 1:10265483-10265505 ACCTTGACCTCCCAAAGAGTGGG 0: 2
1: 172
2: 4362
3: 45466
4: 151100
901583437_901583446 26 Left 901583437 1:10265443-10265465 CCAGGTTGGTCTCGAATTCCTGA 0: 71
1: 4286
2: 69888
3: 232200
4: 226807
Right 901583446 1:10265492-10265514 TCCCAAAGAGTGGGGATTCCAGG 0: 1
1: 5
2: 704
3: 28206
4: 338906

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901583437 Original CRISPR TCAGGAATTCGAGACCAACC TGG (reversed) Intronic
Too many off-targets to display for this crispr