ID: 901583438

View in Genome Browser
Species Human (GRCh38)
Location 1:10265461-10265483
Sequence TGGGCAGATTGCTTGAGCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110955
Summary {0: 308, 1: 1846, 2: 7218, 3: 28761, 4: 72822}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901583438_901583444 0 Left 901583438 1:10265461-10265483 CCTGAGCTCAAGCAATCTGCCCA 0: 308
1: 1846
2: 7218
3: 28761
4: 72822
Right 901583444 1:10265484-10265506 CCTTGACCTCCCAAAGAGTGGGG 0: 1
1: 10
2: 614
3: 12329
4: 117312
901583438_901583446 8 Left 901583438 1:10265461-10265483 CCTGAGCTCAAGCAATCTGCCCA 0: 308
1: 1846
2: 7218
3: 28761
4: 72822
Right 901583446 1:10265492-10265514 TCCCAAAGAGTGGGGATTCCAGG 0: 1
1: 5
2: 704
3: 28206
4: 338906
901583438_901583441 -2 Left 901583438 1:10265461-10265483 CCTGAGCTCAAGCAATCTGCCCA 0: 308
1: 1846
2: 7218
3: 28761
4: 72822
Right 901583441 1:10265482-10265504 CACCTTGACCTCCCAAAGAGTGG 0: 2
1: 6
2: 212
3: 779
4: 1702
901583438_901583442 -1 Left 901583438 1:10265461-10265483 CCTGAGCTCAAGCAATCTGCCCA 0: 308
1: 1846
2: 7218
3: 28761
4: 72822
Right 901583442 1:10265483-10265505 ACCTTGACCTCCCAAAGAGTGGG 0: 2
1: 172
2: 4362
3: 45466
4: 151100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901583438 Original CRISPR TGGGCAGATTGCTTGAGCTC AGG (reversed) Intronic
Too many off-targets to display for this crispr