ID: 901583441

View in Genome Browser
Species Human (GRCh38)
Location 1:10265482-10265504
Sequence CACCTTGACCTCCCAAAGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2701
Summary {0: 2, 1: 6, 2: 212, 3: 779, 4: 1702}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901583437_901583441 16 Left 901583437 1:10265443-10265465 CCAGGTTGGTCTCGAATTCCTGA 0: 71
1: 4286
2: 69888
3: 232200
4: 226807
Right 901583441 1:10265482-10265504 CACCTTGACCTCCCAAAGAGTGG 0: 2
1: 6
2: 212
3: 779
4: 1702
901583435_901583441 25 Left 901583435 1:10265434-10265456 CCATGTTACCCAGGTTGGTCTCG 0: 12
1: 982
2: 50916
3: 133028
4: 214354
Right 901583441 1:10265482-10265504 CACCTTGACCTCCCAAAGAGTGG 0: 2
1: 6
2: 212
3: 779
4: 1702
901583436_901583441 17 Left 901583436 1:10265442-10265464 CCCAGGTTGGTCTCGAATTCCTG 0: 48
1: 1384
2: 17107
3: 63559
4: 66620
Right 901583441 1:10265482-10265504 CACCTTGACCTCCCAAAGAGTGG 0: 2
1: 6
2: 212
3: 779
4: 1702
901583438_901583441 -2 Left 901583438 1:10265461-10265483 CCTGAGCTCAAGCAATCTGCCCA 0: 308
1: 1846
2: 7218
3: 28761
4: 72822
Right 901583441 1:10265482-10265504 CACCTTGACCTCCCAAAGAGTGG 0: 2
1: 6
2: 212
3: 779
4: 1702

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901583441 Original CRISPR CACCTTGACCTCCCAAAGAG TGG Intronic
Too many off-targets to display for this crispr