ID: 901585014

View in Genome Browser
Species Human (GRCh38)
Location 1:10282903-10282925
Sequence CTGTTAATAAAGATGAAGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 406
Summary {0: 1, 1: 0, 2: 0, 3: 36, 4: 369}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901585014 Original CRISPR CTGTTAATAAAGATGAAGTT TGG Intronic
900725237 1:4212165-4212187 CTGATAAAAAAGAGGAAATTTGG + Intergenic
900965705 1:5956821-5956843 CTGCTCATAAAGATGTATTTGGG - Intronic
901327512 1:8377035-8377057 TTTTTAATTAAGTTGAAGTTAGG - Intronic
901585014 1:10282903-10282925 CTGTTAATAAAGATGAAGTTTGG + Intronic
903274633 1:22212767-22212789 CTGTTAATAAAGAATAATTATGG + Intergenic
904573050 1:31482124-31482146 CTGTTTATTAAGAGGAAGTGGGG - Intergenic
905246933 1:36621573-36621595 CTGTGAATACAGATGAGGCTTGG + Intergenic
905378118 1:37538872-37538894 CTGAAAATATAGATGAAGTTTGG - Intronic
905512036 1:38529505-38529527 CCATTAATGAAGATGAAGTGGGG + Intergenic
906420770 1:45664986-45665008 CTGTTAAAAAAGATGAAAGATGG + Intronic
906814351 1:48862641-48862663 CAGTTAACAAAAATGAAGTCTGG - Intronic
906925870 1:50115908-50115930 CTGTGATTGGAGATGAAGTTAGG + Intronic
908553923 1:65237966-65237988 CTGTTAATAAAGACATACTTGGG + Intergenic
908661291 1:66438264-66438286 CTGCTATTATAGATGCAGTTAGG - Intergenic
908694266 1:66819905-66819927 TTTTTAAAAAAGATGAATTTAGG + Intronic
908877429 1:68693884-68693906 CTGATAATAAAGATGGACTTAGG + Intergenic
908954098 1:69600163-69600185 ATGATAATAAAGAGGAAATTGGG - Intronic
909113134 1:71504609-71504631 CTTTTAATAAATTTGAAGGTGGG + Intronic
909193031 1:72578683-72578705 ATGGTAATAAAAATGAAGCTGGG - Intergenic
910653343 1:89593429-89593451 AAGTTAATAAAGATGAAGAATGG + Exonic
910943392 1:92561349-92561371 CTTTTCAAAAAGATGCAGTTTGG + Intronic
911329572 1:96511603-96511625 TTTTTAATAGAGATGAGGTTTGG - Intergenic
911436983 1:97872981-97873003 CTGAAAATAAAGATGAAGGAGGG - Intronic
911806728 1:102219576-102219598 CTGTTAATATGGATGACTTTTGG + Intergenic
912507281 1:110165043-110165065 CTGTTACTAAAGATGAGATCTGG - Intronic
912536560 1:110377601-110377623 CTGTTAAAAAAGGAGATGTTGGG + Intronic
912707563 1:111926380-111926402 CTCTTATTAAAGATGAGGTGAGG + Intronic
912787950 1:112622284-112622306 CACTTTATAAAGAGGAAGTTGGG + Intronic
916657702 1:166891976-166891998 GAGTTCATAAAGATGAAGCTAGG - Intergenic
917896413 1:179492493-179492515 CACTGAATAAAGATGAAGTCTGG + Intronic
918025279 1:180738187-180738209 TTTTTAGTAGAGATGAAGTTTGG + Intronic
918725206 1:187912733-187912755 CTGTGAAGAGAGATGAACTTGGG + Intergenic
919664541 1:200279408-200279430 AAGTAAATAAAGATGAAATTTGG + Intergenic
920510402 1:206547315-206547337 CTGTAAATACAGATGAAGCGTGG - Intronic
924725173 1:246663009-246663031 TTGTTAACATAGATGAAGTGGGG + Intronic
1063506157 10:6601597-6601619 CTGTGAACACAGATGAAGTTTGG + Intergenic
1065990826 10:31008260-31008282 CTGTTAAAAAAGAAGAAGTGAGG - Intronic
1066533770 10:36367987-36368009 CTGGAAATAAAGATGAAGAAGGG + Intergenic
1068168991 10:53369507-53369529 CAGTTAATAAAGCAGAAGGTTGG + Intergenic
1068266875 10:54661603-54661625 CTAAGAAGAAAGATGAAGTTGGG + Intronic
1068620275 10:59174808-59174830 GTGTTAAGAAAGAGGAAGTATGG - Intergenic
1068671155 10:59725018-59725040 TTGTTATTAAATATGAAGTCAGG - Intronic
1069003548 10:63292689-63292711 CTGTTAATAAAGAGGGACTATGG - Intronic
1070279666 10:75039227-75039249 CTGTTCCTAAAGATGAACTGTGG - Intronic
1071145065 10:82559261-82559283 ATGTGAATAAAGATGTATTTAGG + Intronic
1071175519 10:82922538-82922560 CTGTTTATCAAGATGAGGGTGGG - Intronic
1071574113 10:86713543-86713565 CTGCTAAAAAAGATTAAGATTGG - Intronic
1075880220 10:125844822-125844844 AGCTTAATAAAGATGATGTTTGG - Intronic
1076815621 10:132913388-132913410 CTGTAAATGCAGATGGAGTTTGG - Intronic
1077601067 11:3575393-3575415 CTTTTAGTAGAGATGAGGTTTGG - Intergenic
1078264853 11:9747353-9747375 CTGATAATGAAGATGAAGAAAGG - Intronic
1078765537 11:14293471-14293493 CAGTTAAAAAAGATGAGATTTGG - Intronic
1079275790 11:19036275-19036297 CTTTTAATAAAGACAAAGATAGG + Intergenic
1079976780 11:27101623-27101645 CCATTAATAAAAATGAAGTCAGG - Intronic
1081380494 11:42408713-42408735 CTGTTAATAATAATGAAGACTGG - Intergenic
1081730507 11:45368801-45368823 CTGTTAAGACAGATGAAAATGGG + Intergenic
1082703603 11:56464737-56464759 GTGTTAATAGAAATGAATTTTGG - Intergenic
1082828872 11:57600653-57600675 GTGATAAGAAAGATGAAATTAGG + Intronic
1083709223 11:64537805-64537827 GTGTAAATAAGGATTAAGTTTGG + Intergenic
1083968682 11:66059004-66059026 CTCTTAAAGAAGATAAAGTTGGG - Exonic
1084256987 11:67949967-67949989 CTTTTAGTAGAGATGAGGTTTGG - Intergenic
1084455686 11:69266923-69266945 CTGTAAATACAGATGAAGCTTGG - Intergenic
1085751914 11:79169159-79169181 CTGTTAATCTAGATAAAGCTTGG - Intronic
1085897392 11:80656160-80656182 CTGTTACATAACATGAAGTTTGG - Intergenic
1086048815 11:82565021-82565043 CTATAAATAGAGCTGAAGTTTGG - Intergenic
1086140687 11:83495578-83495600 CTGCTATTAAAGAGGAAGATTGG + Intronic
1087894925 11:103576560-103576582 CAGTTAATAAAAATGTAGATTGG + Intergenic
1090050643 11:123375622-123375644 ATATGAATAAAGAGGAAGTTTGG + Intergenic
1090475328 11:127015006-127015028 CTGTTAGTAAGGATGAAGCTGGG - Intergenic
1092677705 12:10941076-10941098 CAGGCAATAAAGATGAGGTTGGG + Intronic
1093202523 12:16206760-16206782 CTGTGGATAAAAATGAAGTCAGG + Intronic
1093246201 12:16740177-16740199 CTGTTAAAAAAGATGAGGTAAGG + Intergenic
1093594010 12:20940272-20940294 CAGTTAATAAAAATGTAGATTGG - Intergenic
1095241234 12:39861204-39861226 CTGTAATAGAAGATGAAGTTGGG - Intronic
1095684522 12:45017362-45017384 ATGTTAAAAAAACTGAAGTTTGG + Intronic
1096207828 12:49738274-49738296 CAGTTAATAAAAATGTAGATTGG + Intronic
1096246081 12:49987603-49987625 CTGTTAAAGAAGTTGAAGGTGGG + Intronic
1096649559 12:53055294-53055316 CTATTAATAACGAGGAAGCTGGG - Intronic
1097651368 12:62301838-62301860 CTGTTAATTAAGACTAACTTAGG + Intronic
1099752350 12:86791992-86792014 TTGTTAATAAAGAAAAAGTTAGG - Intronic
1100661380 12:96702603-96702625 TAGTTGATAAAAATGAAGTTTGG - Intronic
1100889112 12:99104199-99104221 CAGATAATAAAGATCAAGTGAGG + Intronic
1101015038 12:100491444-100491466 TTGTAAATAAAAATGAAGTCTGG - Intronic
1101121952 12:101591232-101591254 CTATTAAAAAAGATTGAGTTAGG + Intronic
1101804237 12:108049369-108049391 CTGTTAAAAATGATGGAATTGGG + Intergenic
1103138703 12:118530017-118530039 CTTGGAAGAAAGATGAAGTTTGG - Intergenic
1103151231 12:118640750-118640772 CAGTTAATACATATGAACTTTGG + Intergenic
1105895427 13:24713232-24713254 CTGTCAAGAAAGATTAAGTAAGG - Intergenic
1106444257 13:29810892-29810914 CTGTTAAAAATTATGAATTTTGG + Intronic
1107027057 13:35812740-35812762 CTGTTGATCAGGATCAAGTTTGG + Intronic
1107041244 13:35950227-35950249 GTTATAATAAAGATGAATTTAGG + Intronic
1107761025 13:43678891-43678913 TTGTAAATAAAGTTGATGTTTGG - Intronic
1107761156 13:43680563-43680585 CAGTTAATTATGGTGAAGTTGGG - Intronic
1108781391 13:53840369-53840391 TTGTTTATACAGTTGAAGTTTGG - Intergenic
1109685980 13:65819921-65819943 CTATAAATAAAGATGAGATTTGG - Intergenic
1110103997 13:71647131-71647153 CTGTTAATAAAAATGATACTTGG + Intronic
1110237798 13:73234510-73234532 ATGTCAATAATGATGATGTTGGG + Intergenic
1110270283 13:73581627-73581649 CTCTTAATAAAAAGAAAGTTGGG + Intergenic
1110485218 13:76032118-76032140 CTGTTAAGAAAGATACAGATTGG - Intergenic
1110557075 13:76871809-76871831 CTGTTAAAAATGTTGATGTTGGG - Intergenic
1111100816 13:83583741-83583763 CTATTAATAAAATTGAATTTGGG - Intergenic
1111301584 13:86357526-86357548 CTGTTCATAAAGATGCACTTTGG + Intergenic
1111444097 13:88322694-88322716 CTTTTAATAAAGATAAAATAGGG - Intergenic
1114131509 14:19798602-19798624 CTGTTAGAAAAGAAGTAGTTTGG + Intronic
1115192259 14:30758213-30758235 CTGTTAAAAAAGAGCTAGTTTGG - Intergenic
1115201653 14:30860379-30860401 CTGATCATAAAGATGCAGGTGGG + Intergenic
1115948374 14:38691543-38691565 TTTTTAAAAAAGATGAACTTAGG + Intergenic
1116408501 14:44595294-44595316 GTGTTAATGAGGATGAATTTGGG - Intergenic
1117630951 14:57690884-57690906 CTCTAAATACAGATGAAGCTTGG + Intronic
1117835221 14:59797782-59797804 GTGTTAACAAAGATGACGCTAGG - Intronic
1118696366 14:68389857-68389879 CTGGTAATCAAGACCAAGTTGGG + Intronic
1121031956 14:90665682-90665704 CTTTTAATAGTGATGAATTTTGG - Intronic
1121268736 14:92623437-92623459 CTATTAATAAAAATGTAGCTTGG - Intronic
1123894293 15:24813156-24813178 CTATTAATAGAGCTGAAATTTGG + Intergenic
1124639713 15:31390045-31390067 CTGTTAATAAAAAGGAAGCAAGG - Intronic
1125135183 15:36333047-36333069 CTGTAAATATAGATGAAACTTGG - Intergenic
1125590161 15:40849356-40849378 CTATTCATGAAGATGAGGTTGGG - Intronic
1127063550 15:55213562-55213584 CTGTAAATACAGATGAAACTTGG - Intronic
1127249588 15:57218107-57218129 ATGTTAGTAAAAATGAGGTTGGG + Intronic
1128192914 15:65720732-65720754 CAGTTAACAAGGATGAAGCTGGG - Intronic
1129206882 15:74042499-74042521 CTGCTCAGAAAGATGAAATTAGG + Intronic
1130278242 15:82495020-82495042 CTGTAAATAAAAATGTAGATCGG + Intergenic
1130470571 15:84222205-84222227 CTGTAAATAAAAATGTAGATCGG + Intergenic
1130478059 15:84336772-84336794 CTGTAAATAAAAATGTAGATCGG + Intergenic
1130493706 15:84451358-84451380 CTGTAAATAAAAATGTAGATCGG - Intergenic
1130592858 15:85226831-85226853 CTGTAAATAAAAATGTAGATTGG + Intergenic
1130847755 15:87763142-87763164 CTTTTAAGAAAGATAATGTTAGG - Intergenic
1133214236 16:4281651-4281673 CTGTAGATACAGATGAAGCTTGG + Intergenic
1133556493 16:6910898-6910920 CTGTTAGTAAAGAGGAAGGAGGG + Intronic
1134379043 16:13707402-13707424 CTGTAAATACAGATGAAGCTTGG - Intergenic
1134795521 16:17032117-17032139 CTGCTAATAAAGATGGAGAGAGG - Intergenic
1135246200 16:20859389-20859411 CTGTTTACATAGATGAATTTAGG - Exonic
1138073684 16:54019334-54019356 CTGTTAACAAGGAAGAAGGTGGG + Intronic
1140920619 16:79534249-79534271 CTGTTACTTAAAATAAAGTTAGG + Intergenic
1141350178 16:83287401-83287423 CTGTAAATACAGATGAAGCTTGG - Intronic
1141755247 16:85986672-85986694 CTCTTACTAAATATCAAGTTTGG + Intergenic
1141774667 16:86115270-86115292 CTGATAATAAATATCAAGTGTGG + Intergenic
1143061593 17:4206619-4206641 TTGTGAATAAAGTTGAATTTGGG - Intronic
1146422527 17:32701597-32701619 CTGTCACTTAAGCTGAAGTTCGG + Intronic
1146471024 17:33125046-33125068 CTGTAAACACAGATGAAGCTTGG + Intronic
1146764277 17:35505133-35505155 CAGTTAATAAAAATGTAGATTGG + Intronic
1147173900 17:38639646-38639668 CTGTTAAAGAAGTTGAAGGTCGG + Intergenic
1147470618 17:40656650-40656672 CTTTTAATAATGAAGAAGTATGG + Intronic
1148175958 17:45565087-45565109 CTGTTAATTAGGGTAAAGTTGGG + Intergenic
1149403172 17:56319830-56319852 ATGTAAATAATTATGAAGTTCGG - Intronic
1149744858 17:59086762-59086784 CTGTTAATTAAGAGGAGTTTTGG - Intronic
1150455865 17:65305995-65306017 CTGTAAATACAGATGAAGCTTGG + Intergenic
1151948626 17:77333797-77333819 CTTTAAAAAAAAATGAAGTTTGG - Intronic
1155180934 18:23345643-23345665 ATGTTGACAAAGATAAAGTTGGG - Intronic
1155367005 18:25058719-25058741 CTGTAAATACAGATGAAGCTTGG + Intergenic
1155463157 18:26106404-26106426 ATGATAAGAAAGCTGAAGTTTGG - Intergenic
1156301395 18:35839507-35839529 CTATTAATAAAAATGTAGATTGG + Intergenic
1156761356 18:40595483-40595505 TAGTTAATGAAGGTGAAGTTTGG - Intergenic
1157350101 18:46876379-46876401 CTGTAAATAAAAATGTAGATTGG + Intronic
1158226905 18:55210859-55210881 GAGATAATAAAGATGAAGTAAGG + Intergenic
1159002408 18:62986157-62986179 CTGTTCATAAGGAAGAAGTATGG - Intergenic
1159362935 18:67428775-67428797 CTGTCAGTAAAAATGATGTTCGG + Intergenic
1159742066 18:72184458-72184480 CTGTTTGTAAATATTAAGTTTGG - Intergenic
1159788649 18:72747870-72747892 CTGACAATAAAAATAAAGTTGGG + Exonic
1160109048 18:76007574-76007596 GTGTTAATAAGAGTGAAGTTTGG - Intergenic
1162267649 19:9589046-9589068 CAGTTAATAAAAATGTAGATTGG - Intergenic
1162502405 19:11061401-11061423 CTGTAGAGAAACATGAAGTTTGG + Intronic
1162780409 19:13003950-13003972 TTTTTAGTAAAGATGAAGTCTGG + Intronic
1163244642 19:16085766-16085788 CTGGTAGTAAAGATGAAGGGAGG + Intronic
1163498146 19:17658893-17658915 TTCTTATTAAACATGAAGTTTGG - Intronic
1163991964 19:21007148-21007170 CAGTTAATAAAAATGTAGATTGG + Intergenic
1164130555 19:22357707-22357729 CAGTTAATAAAAATGTAGATTGG - Intergenic
1165589717 19:36957407-36957429 TTTTTAGTAAAGATGAGGTTTGG + Intronic
1165963228 19:39552770-39552792 CTTTTAATAAATAAGAAATTTGG + Intergenic
1166913807 19:46180107-46180129 CTCTCAATCAAGATGGAGTTAGG - Intergenic
1167424985 19:49425607-49425629 CTGTTATTGAAGATGGAGCTAGG - Intronic
1168461586 19:56563719-56563741 CTGTTAACAAAGAGGACATTAGG - Intergenic
927105732 2:19822254-19822276 CTTTTATTAAGAATGAAGTTGGG - Intergenic
928628360 2:33164401-33164423 CTATGAATAAATCTGAAGTTTGG + Intronic
929679904 2:43982200-43982222 CTGTTCATAAAGTTGACTTTTGG - Intronic
929765415 2:44839978-44840000 CTGTAAACAAAGATGTATTTGGG + Intergenic
931267876 2:60676378-60676400 CTCTTTTTAAAGATGAACTTTGG + Intergenic
932446328 2:71783917-71783939 CTGTGAATAACTATGCAGTTTGG - Intergenic
932910040 2:75796821-75796843 CTGTGAACAAAAATGAAGCTGGG + Intergenic
933885454 2:86715838-86715860 CTGTTAATAAAAATGAATCAGGG - Intronic
934927877 2:98394326-98394348 CTTTTAAAATATATGAAGTTCGG - Intronic
935026354 2:99281030-99281052 CTTTTGATAAAGGTGAATTTAGG - Intronic
935100822 2:99994104-99994126 TTTTTAAAAAAGATTAAGTTTGG - Intronic
935123728 2:100203920-100203942 CTCTCATTAAAGATGAATTTGGG + Intergenic
935219482 2:101000485-101000507 CTGTTAACAAAGAAGAAGAGGGG - Intergenic
935814149 2:106830740-106830762 CTGTTACTGTAGATGAAATTTGG - Intronic
936534261 2:113299572-113299594 CTTTTAATAAAGAGAATGTTTGG - Intergenic
936704018 2:115049218-115049240 ATAATAATAATGATGAAGTTGGG + Intronic
936816348 2:116465963-116465985 TTGTTAATAAAGATGATTTTGGG + Intergenic
937583651 2:123520036-123520058 CTGCTAATAAAGATGGGTTTTGG + Intergenic
938128648 2:128692428-128692450 CTCTTTAAAAAGATGGAGTTAGG + Intergenic
938737008 2:134194911-134194933 CTGATAATGCAGTTGAAGTTGGG + Intronic
939306319 2:140416092-140416114 TTGTGAATACAGATGAAGCTTGG - Intronic
939871516 2:147531465-147531487 CTGTTTTTATGGATGAAGTTTGG + Intergenic
940296718 2:152133396-152133418 CTGTTTATATAGATGAGGTAGGG - Exonic
940523904 2:154787007-154787029 CTGTTAATAATGATAACGGTTGG + Intronic
941721410 2:168816897-168816919 ACGTTAATGAAGATCAAGTTAGG + Intronic
943408210 2:187514895-187514917 CAGTTAATAAAAATGTAGATTGG + Intronic
944361086 2:198857581-198857603 CTGTAAATGTAGATGAAATTAGG + Intergenic
944962777 2:204894490-204894512 CTGTTAATAATGAGGAAGCTGGG - Intronic
945289849 2:208116288-208116310 CGGTTAATAAAAATGTAGATTGG + Intergenic
945401128 2:209384587-209384609 CTCTGAATAAAGATGAATATAGG + Intergenic
945746980 2:213730308-213730330 TAGTGAATAAAGAAGAAGTTTGG + Intronic
945878440 2:215302775-215302797 CAGTTCATAAGCATGAAGTTTGG + Intergenic
1169832829 20:9842710-9842732 CTGTTACTGAAAATGGAGTTAGG - Intergenic
1170223261 20:13963777-13963799 CTGGTAACAAGGGTGAAGTTAGG - Intronic
1174795298 20:53517306-53517328 CTGTAAACACAGATGAAGCTTGG - Intergenic
1175552219 20:59824926-59824948 CTGTGAATGACGATGAACTTTGG + Intronic
1176294895 21:5066226-5066248 CTGGTAATAAAGATATAATTAGG - Intergenic
1177227021 21:18270440-18270462 CTGTTAATAAATATTTTGTTTGG - Intronic
1177560986 21:22753509-22753531 CTGAAATTAAAGATGATGTTTGG - Intergenic
1178475062 21:32930892-32930914 CTGTAAATACAGATGAAGCTTGG + Intergenic
1179282692 21:39947917-39947939 CTGTTAAGAAAGGTGAAGAAAGG + Intergenic
1179670774 21:42945993-42946015 CAGTTAATAAAAATGTAGATTGG - Intergenic
1179862154 21:44195900-44195922 CTGGTAATAAAGATATAATTAGG + Intergenic
1181375966 22:22458294-22458316 CTGTAAATAAAAATGTAGATTGG + Intergenic
1181829582 22:25549258-25549280 CTGTAAATACAGATGAAGCTTGG - Intergenic
949285171 3:2394400-2394422 CTGTTAATAAAGGAGACTTTGGG - Intronic
950750580 3:15124754-15124776 CTTTTAGTAGAGATGAGGTTTGG + Intergenic
951866502 3:27314514-27314536 CTATTAATAAATATGAAAGTTGG + Intronic
952497259 3:33926691-33926713 CTGTTCATAATGATGACCTTAGG - Intergenic
953083665 3:39645745-39645767 CTTTTTATAAACATGAGGTTGGG - Intergenic
954090147 3:48277714-48277736 CTATTAATAAAAATGTAGCTTGG + Intronic
954475936 3:50745761-50745783 AAGTTAATAAAGTTGATGTTGGG - Intronic
954586610 3:51742044-51742066 CTGTAAATAAAAATGTAGATTGG + Intergenic
957989068 3:87608151-87608173 CTGTAAATAAAAATGTAGATTGG - Intergenic
959409428 3:106001819-106001841 CTGTTAATACAGATCAAGTAGGG - Intergenic
959783622 3:110266701-110266723 CTGTCAATGAAGATGTAGCTTGG - Intergenic
960328678 3:116329478-116329500 ATTTTAATAAACATGAACTTTGG + Intronic
960534987 3:118805626-118805648 CAGTCTATAAAGATGAATTTGGG - Intergenic
960808980 3:121610537-121610559 CTGTTAATTATGATAAAGTCAGG - Intronic
963166026 3:142204376-142204398 CTTTTATAAAAGATGAAATTTGG + Intronic
963442212 3:145355031-145355053 CTATTAATAAAAATGTAGATTGG - Intergenic
963969623 3:151415322-151415344 AAGTTAATAATGATGAAGTTGGG + Intronic
964458777 3:156897773-156897795 GTTTTAGTAAAGATGAGGTTTGG - Intronic
964611884 3:158624065-158624087 CTATTAATAAACATGTAGCTTGG - Intergenic
964932910 3:162047757-162047779 CAGTTAATAAAAATGTAGATTGG - Intergenic
965323418 3:167273912-167273934 CTATTAATAAAAATGTAGATTGG + Intronic
965777239 3:172244036-172244058 CTGTTAAGAAAGCAGAAGTGTGG - Intronic
966273312 3:178134942-178134964 CTATAAATCAAGATGAGGTTTGG + Intergenic
968197680 3:196722419-196722441 CTTTTAATCAAAGTGAAGTTTGG + Exonic
969738446 4:9006594-9006616 CTTTTAGTAGAGATGAGGTTTGG + Intergenic
970043159 4:11819787-11819809 GTGAGAATAAAGATGAAGCTTGG + Intergenic
970352312 4:15214986-15215008 CTGTTACCAAGGATGAAGATGGG - Intergenic
971618235 4:28822016-28822038 CTATTAATAAAAATGAACTGTGG - Intergenic
971837391 4:31786161-31786183 CTGTAAATACAGATAAAGCTTGG - Intergenic
972100710 4:35411806-35411828 ATGTAAATAAAGATGATATTGGG + Intergenic
972165428 4:36277856-36277878 CTGAAAGTAAAGATGAACTTAGG - Intergenic
972487226 4:39553769-39553791 CTTTTAATAGAGACGGAGTTTGG + Intronic
972947439 4:44273539-44273561 CTGGGAAAAAAGATGAAGATGGG + Intronic
972951130 4:44323758-44323780 CTGTTAATAAGAAATAAGTTTGG + Intronic
973033266 4:45372105-45372127 GAATTACTAAAGATGAAGTTGGG + Intergenic
973050906 4:45594413-45594435 CTGTGGATAAAGATGATTTTTGG + Intergenic
973153083 4:46912222-46912244 CTATTATTAAAGATGAGATTTGG + Intergenic
973992222 4:56421042-56421064 CTGTAAATACAGATGAAGCTTGG - Intronic
974223185 4:59003101-59003123 CTGTTAGAAAAGAAGTAGTTTGG - Intergenic
974368741 4:60986684-60986706 CTGTGAATAATGTTGAAGTTGGG - Intergenic
974376883 4:61089556-61089578 GTGTTAATCAACATGAATTTAGG + Intergenic
974616966 4:64300645-64300667 CTGTTAATAAATATGATGATAGG - Intronic
975603991 4:76134318-76134340 CCAGTAATAAAGATGAAGATGGG - Exonic
976004245 4:80409693-80409715 CTGTCAATAAGGATCAAATTTGG - Intronic
977296400 4:95214309-95214331 CTGTTTATAAAAATGAAGCTAGG - Intronic
977910147 4:102524891-102524913 CTGTATATACAGATGAAGCTTGG + Intronic
977972489 4:103228215-103228237 CAGTTAATAAAAATGTAGATTGG + Intergenic
978926168 4:114248001-114248023 CTATTAATAAAGAATAAATTTGG - Intergenic
980540879 4:134193207-134193229 CTCTTTAAAAAGATGAAGTAGGG - Intergenic
981182651 4:141763963-141763985 CTGTAAATACACATGAAGCTGGG + Intergenic
981359743 4:143832361-143832383 CTATAAATCAAGATGAAATTTGG - Intergenic
981574590 4:146191464-146191486 CTTTTAATCAAGATCAACTTTGG + Intronic
981980094 4:150781474-150781496 CTATAAATACAGATGAAGCTTGG + Intronic
982752645 4:159180475-159180497 CTGCTATTATAGATGCAGTTAGG - Intronic
983333808 4:166366713-166366735 TTGTGAATAAAGCTGAGGTTGGG - Intergenic
984269573 4:177534937-177534959 CTGTTTATAAAGATGCAGCTAGG - Intergenic
984417930 4:179484223-179484245 CTGTAAATTAAGATGATGTGGGG + Intergenic
984460701 4:180033091-180033113 CTGTTTATATATATGAAGTATGG - Intergenic
984525410 4:180852426-180852448 ACATTAATAAAAATGAAGTTTGG + Intergenic
986056344 5:4140827-4140849 CTGTAATTCAAGATGAAATTTGG + Intergenic
986908457 5:12524003-12524025 CTGATAAAAAATATGAACTTTGG - Intergenic
986998651 5:13636267-13636289 GTGATAATATAGATGAACTTTGG + Intergenic
987882753 5:23770289-23770311 CAATTTATAAAGTTGAAGTTTGG - Intergenic
988192210 5:27953132-27953154 CTATAAATAAAAATGAACTTTGG - Intergenic
988535006 5:32059520-32059542 ATGTTAATATAAATGAAATTTGG + Intronic
989153354 5:38321345-38321367 CTGTAAATACAGACGAAGCTTGG + Intronic
991216383 5:64160952-64160974 CTATTAATAAAAATGTAGATTGG + Intergenic
991306187 5:65178399-65178421 CAGTTAATAAAAATGTAGATTGG + Intronic
993108803 5:83630658-83630680 CTGCTAATAAATAAGAAATTAGG + Intergenic
993383982 5:87241822-87241844 CCGTGAAAAAAGATGAATTTGGG + Intergenic
993572391 5:89557606-89557628 CTGGTAAAAAAGATGATGGTGGG + Intergenic
993737814 5:91498703-91498725 CTGTTTATAATTTTGAAGTTTGG - Intergenic
994159370 5:96538397-96538419 CTGTTAGAAAAGATAAGGTTTGG + Intronic
994337703 5:98588071-98588093 CTGATAATAAAAATGAATATTGG + Intergenic
994671479 5:102766515-102766537 CTGTAAATACAGATGAAGCTTGG + Intronic
995067867 5:107882741-107882763 CTGCTAAGAAAAATGAAGTAGGG + Intronic
996040332 5:118802246-118802268 TAGTTAATGAAGATGTAGTTTGG - Intergenic
997495702 5:134322679-134322701 CTGTTAAAAATGATGAGGTCTGG + Intronic
997967132 5:138366869-138366891 CTGTTGACAAAGATGTTGTTTGG - Intronic
999368833 5:151040484-151040506 CTGTAGATAAGGATGAATTTCGG - Intronic
999897538 5:156051785-156051807 CTGTGGATAAACCTGAAGTTTGG + Intronic
999980788 5:156955796-156955818 CTGTTAGATAATATGAAGTTAGG + Intronic
1000386328 5:160677903-160677925 CTGTTAATAAAGCTGCAATTTGG - Intronic
1000440789 5:161260689-161260711 CTGTAAATAATGAGCAAGTTTGG + Intergenic
1001223811 5:169926734-169926756 CTGTAACTAGAGGTGAAGTTTGG + Intronic
1001373624 5:171232637-171232659 CTGTTAATAATGGTTAACTTTGG - Intronic
1001558326 5:172651725-172651747 CAGTTAATAAAAATGTAGATTGG - Intronic
1001687023 5:173601120-173601142 TTGTTAAAAAGGATGTAGTTAGG + Intergenic
1001945386 5:175773643-175773665 CTGTTAATAATGATGATGATTGG - Intergenic
1002982972 6:2160451-2160473 GAGTTAATAAAGTTGGAGTTTGG - Intronic
1004086079 6:12450818-12450840 CTGTTAAAAAAAATGAAGTGGGG + Intergenic
1004780752 6:18905860-18905882 CTATTTATAAAGATGGAGGTAGG - Intergenic
1004922789 6:20392558-20392580 TTGTTAATATAGAGAAAGTTTGG - Intergenic
1004952225 6:20686314-20686336 CTGTAAACACAGATGAAGCTTGG - Intronic
1004972690 6:20929319-20929341 CTGGTAATAAAGATTAACCTTGG + Intronic
1005051251 6:21685874-21685896 CTGTAAACACAGATGAAGCTTGG - Intergenic
1005167537 6:22941695-22941717 TTGATAATAAAGAACAAGTTGGG - Intergenic
1005462047 6:26078516-26078538 CAGTTAATAAAAATGTAGATTGG + Intergenic
1006262843 6:32891030-32891052 TTGAAAATAAAGAGGAAGTTGGG - Intergenic
1007089342 6:39172510-39172532 ATGTCAATAATGCTGAAGTTGGG - Intergenic
1007600630 6:43078614-43078636 CTGTTAATAAGGCTGGAGTAAGG + Intronic
1008123580 6:47644945-47644967 CAGTTAATAAAAATGTAGATTGG + Intergenic
1008275503 6:49539555-49539577 TTATTATTAAAGAGGAAGTTTGG + Intergenic
1009315244 6:62210797-62210819 TTGATATTAAAGATGAGGTTAGG + Intronic
1011813855 6:91165276-91165298 CAGATAATAAATATGAAATTGGG - Intergenic
1012768121 6:103395817-103395839 CTGTAATTCAAGATGAAATTTGG - Intergenic
1013085601 6:106854510-106854532 CTGTTTAAAAAGAGGAAATTTGG + Intergenic
1013085714 6:106855384-106855406 CTGTCATCAAAGATGAAGCTTGG - Intergenic
1013824548 6:114195645-114195667 TTGTTAATAAATATGCAATTAGG + Intronic
1014052088 6:116966626-116966648 CTGTTAATATAGATGTATGTGGG - Intergenic
1015343733 6:132131416-132131438 CTGTTTATAAAGTTGAGTTTGGG + Intergenic
1015989308 6:138919751-138919773 CTGTGAATAAAAATAAAGCTGGG - Intronic
1016841397 6:148529110-148529132 CTGTGAAAACAGATGAAGCTTGG + Intronic
1016971742 6:149770407-149770429 CTGTTACTAAAGACCAGGTTGGG + Intronic
1017339186 6:153300763-153300785 CTGTAAATAACAATAAAGTTTGG - Intergenic
1017393222 6:153964586-153964608 TTGTTAATAGAGAAGAATTTAGG + Intergenic
1018000536 6:159574708-159574730 CCTGTAATAAAGATGAGGTTTGG - Intergenic
1018216396 6:161531990-161532012 CATTTAATAAAGAAGGAGTTTGG + Intronic
1020184334 7:5947411-5947433 CTGTAAAAACAGATGAAGGTAGG + Intronic
1020298583 7:6777355-6777377 CTGTAAAAACAGATGAAGGTAGG - Intronic
1020838885 7:13189352-13189374 CTGTGAACAAGGATGAACTTTGG + Intergenic
1021295361 7:18899190-18899212 CTATTAATAAAAATGCTGTTTGG + Intronic
1021377653 7:19928099-19928121 TTGTTATAAAAGATGAAATTAGG + Intergenic
1021881792 7:25102088-25102110 CTACTGATAAAGATGAAGCTGGG - Intergenic
1021917963 7:25454743-25454765 CTGTTAATAGTGCTGAGGTTGGG - Intergenic
1022245812 7:28558231-28558253 CTGTTAATGACGACTAAGTTTGG + Intronic
1022603189 7:31781301-31781323 CCATTAATAATGATGATGTTTGG - Intronic
1022706986 7:32810939-32810961 CTCTTAAAAAAAAAGAAGTTAGG + Intergenic
1023960633 7:44923118-44923140 CTGTTAATAAATATGTGGGTAGG - Intergenic
1024813052 7:53235835-53235857 CAGTTAATAAAAATGTAGATTGG + Intergenic
1024954634 7:54904013-54904035 GTGATAATAATGAAGAAGTTAGG + Intergenic
1026316025 7:69228396-69228418 CTGCAAATACAGATGAAGCTTGG + Intergenic
1027689793 7:81330085-81330107 TTGTTAATAAAGGTGTACTTAGG - Intergenic
1028261499 7:88672363-88672385 CTGATAATAGAGATGAAGGAGGG + Intergenic
1028924903 7:96347308-96347330 ATGTTAATAAAGATAAAATCTGG + Intergenic
1029846269 7:103415177-103415199 ATGTTATTATACATGAAGTTAGG - Intronic
1030459860 7:109820892-109820914 ATCTAAATAAAGATGAATTTTGG - Intergenic
1030536831 7:110777788-110777810 CTGTTAAAAAAGATATAGTTTGG + Intronic
1031720470 7:125169095-125169117 CTGGTAATGAGAATGAAGTTTGG + Intergenic
1032170659 7:129582000-129582022 CAGTTAATAAAAATGTAGATTGG + Intergenic
1032890288 7:136187470-136187492 CTGATAATAAAAATGAGTTTGGG + Intergenic
1033943334 7:146682462-146682484 CTGTGAACTAACATGAAGTTTGG - Intronic
1034068767 7:148162350-148162372 CTGTTAATAATTTTGAAATTTGG + Intronic
1035762819 8:2081811-2081833 CAGTTGATAAAGTGGAAGTTTGG + Intronic
1036104260 8:5823524-5823546 CAGTTAATAAAAATGTAGATTGG - Intergenic
1038089770 8:24240083-24240105 CAGTTAATAAAAATGTAGATTGG + Intergenic
1038657330 8:29465761-29465783 CTGTAAATATAGATGAAGCTTGG - Intergenic
1038738087 8:30190575-30190597 TTTTTAATAAAGATGAGGTCTGG - Intergenic
1038863630 8:31414846-31414868 CTGTAAATACAGATGATGCTTGG + Intergenic
1038938990 8:32283128-32283150 ATGCTAATAAAGATGTAGTATGG - Intronic
1040456343 8:47601813-47601835 CTGTGTACAAAGATGAACTTTGG + Intronic
1042050226 8:64696073-64696095 CTGTTAATAAATCTGTTGTTGGG - Intronic
1043032533 8:75155279-75155301 CTTTTTAGAAAGATGAAGTAAGG - Intergenic
1043707090 8:83363932-83363954 ATTTTAATAAAGCTGAAGTGGGG + Intergenic
1045076418 8:98574073-98574095 CTATAATTAAAGATGAAATTTGG + Intronic
1045717397 8:105064618-105064640 TTGTTTATAAAAATGAAATTTGG + Intronic
1046634648 8:116660722-116660744 GTGTTAATATAGAGGAAGTTAGG + Intronic
1047485353 8:125325654-125325676 CTATTTTTAAAAATGAAGTTGGG + Intronic
1048460133 8:134614668-134614690 GTGTTCAAAAAGATGAAGCTAGG + Intronic
1049061602 8:140280307-140280329 CTGTTTAGAAAGATGAATTTTGG - Intronic
1049445664 8:142630135-142630157 ATGTTAATGAAGATGATGATGGG - Intergenic
1050435710 9:5607873-5607895 ATGTTGCTAAACATGAAGTTAGG + Intergenic
1051279582 9:15428295-15428317 CTGTTTATACAGATCAACTTTGG + Intronic
1051617589 9:19021032-19021054 TAGGTAATAAAGATGTAGTTTGG - Intronic
1055154811 9:73048537-73048559 CCTTGAAAAAAGATGAAGTTTGG + Intronic
1056131881 9:83595309-83595331 TTTTTAATAGAGATGAGGTTTGG - Intergenic
1058205426 9:102100093-102100115 CTGTCAATAAAGATGATGGCTGG + Intergenic
1058312945 9:103528900-103528922 CTCTTAAAAAAAATGAGGTTGGG + Intergenic
1058649024 9:107157685-107157707 CTGTGAAGAAAAATAAAGTTGGG - Intergenic
1059009004 9:110436222-110436244 CTGTGGTTATAGATGAAGTTAGG - Intronic
1059490747 9:114665585-114665607 CTGTTAATAAAGATATACCTTGG + Intergenic
1185933727 X:4232239-4232261 CTGTACATAAAGATGAAGAATGG - Intergenic
1186204826 X:7190389-7190411 CTGTAAATACAGATGAAGCTTGG + Intergenic
1186570996 X:10715038-10715060 CTCTTCTTAAAAATGAAGTTGGG + Intronic
1187026621 X:15441925-15441947 CTGGTAAGAAAGATGATATTTGG + Intronic
1187200569 X:17130130-17130152 CTGTTAATAAAACTGACTTTTGG + Intronic
1187958560 X:24545161-24545183 CTGTTCATAAAGAAGAGCTTAGG - Intergenic
1188047475 X:25443421-25443443 ATGTTAATAAAAATCTAGTTTGG - Intergenic
1188619609 X:32203859-32203881 TTGTTATTAGAGATGATGTTAGG - Intronic
1194000257 X:88420075-88420097 CTGTAATTAAAGATGAGATTTGG - Intergenic
1194764498 X:97833727-97833749 ATGTTAATAATGTGGAAGTTGGG - Intergenic
1197580932 X:128282933-128282955 TTGTTAGTAATGATGAAGTCTGG - Intergenic
1198087022 X:133291543-133291565 CTGATAAAAAGGATTAAGTTTGG - Intergenic
1198279457 X:135127318-135127340 ATGTTAATAAAGATGAAGAAGGG + Intergenic
1198291499 X:135245196-135245218 ATGTTAATAAAGATGAAGAAGGG - Intergenic
1198305061 X:135373269-135373291 CTGTTAATTTAAATTAAGTTTGG - Intergenic
1198742591 X:139856730-139856752 CAGTTAATAAAAATGTAGATTGG + Intronic
1200853566 Y:7911519-7911541 CTGCCATTATAGATGAAGTTTGG + Intergenic
1201577511 Y:15477023-15477045 CTGTGAATACAGATGAAGCTTGG + Intergenic