ID: 901592316

View in Genome Browser
Species Human (GRCh38)
Location 1:10355486-10355508
Sequence CAGTAGGTTTACATGGGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 121}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901592316 Original CRISPR CAGTAGGTTTACATGGGGAG GGG (reversed) Intronic
901592316 1:10355486-10355508 CAGTAGGTTTACATGGGGAGGGG - Intronic
903125339 1:21243946-21243968 AGGTAGGTTTGCATGGGGATGGG + Intronic
906216529 1:44044133-44044155 CAGAAGGCATACATGGAGAGAGG - Intergenic
907331332 1:53673529-53673551 TAGTAGGTGTACATAGGTAGGGG - Intronic
908399033 1:63752934-63752956 CACTATGTTAACATGGGGCGGGG + Intergenic
915362950 1:155296671-155296693 CAGTAGGTTTACCTGCGGATGGG - Intronic
920445699 1:206014542-206014564 CAGTGGTTTTACAGAGGGAGTGG + Intronic
923024380 1:230193325-230193347 CCGCAGGTGTACAAGGGGAGGGG - Intronic
923425355 1:233863348-233863370 CTTGAGGTTAACATGGGGAGCGG - Intergenic
1062932182 10:1360640-1360662 CTGTGGGTGTGCATGGGGAGCGG + Intronic
1063546591 10:6987555-6987577 TACTAGGTTTGCCTGGGGAGTGG - Intergenic
1067772757 10:49139070-49139092 CAGCAGGTTTGCATGGAGTGGGG + Intergenic
1072711301 10:97717322-97717344 CAGTAGGGGGAGATGGGGAGAGG + Exonic
1073447264 10:103589176-103589198 CAGAAAGCATACATGGGGAGGGG + Intronic
1074066532 10:110019765-110019787 TTGTAGGTTTACTTGGAGAGTGG + Intronic
1074191962 10:111145999-111146021 CAGTTCCTGTACATGGGGAGTGG + Intergenic
1081790018 11:45775888-45775910 CAATAAGTGTGCATGGGGAGAGG + Intergenic
1083470786 11:62882349-62882371 CAGTAGGTTTTTTTGGGGGGGGG + Intronic
1086209374 11:84300123-84300145 TAGTATGTTTACATAGGGATAGG - Intronic
1087054453 11:93919981-93920003 ATGCATGTTTACATGGGGAGTGG + Intergenic
1087477433 11:98653863-98653885 CATTAGGTTTACATGGGTAACGG + Intergenic
1090987069 11:131777445-131777467 CACTAGGATTGCATGGGGTGGGG - Intronic
1091042635 11:132296300-132296322 GAATAGGTTTACCTGGGGAGGGG + Intronic
1091406799 12:214289-214311 CAGTGGGTTCACAGTGGGAGTGG - Intronic
1097536859 12:60883187-60883209 CAGTAGGTTTTCAAGGGAACAGG + Intergenic
1098850151 12:75586683-75586705 CAGTGGGTTTACTTGAGGAATGG + Intergenic
1104965585 12:132507550-132507572 CAGCAGGTTTACAGGGGGCCTGG + Intronic
1111291731 13:86180036-86180058 CAGTAGGGTAAGATGTGGAGGGG + Intergenic
1112938494 13:104830450-104830472 CAGGAGGATTACTTGGGGACAGG - Intergenic
1114453232 14:22839679-22839701 CAGTAGTCTTGCATGGGGACTGG - Intronic
1117507489 14:56417654-56417676 TAGATGGTTTACCTGGGGAGTGG - Intergenic
1119615599 14:76096750-76096772 CAGTAGGTTCGTCTGGGGAGCGG + Intergenic
1122077137 14:99243290-99243312 GAGGAGGTTTATGTGGGGAGGGG - Intronic
1123931227 15:25172599-25172621 CTGGATGTTTGCATGGGGAGGGG + Intergenic
1125598254 15:40901061-40901083 CAGTAGCTTTAGATGTGGAAGGG + Intronic
1125700690 15:41680714-41680736 CTATATGTTTCCATGGGGAGAGG - Intronic
1128516242 15:68343855-68343877 CAGGAGGCTTAAATGGGGTGTGG + Intronic
1129334130 15:74842518-74842540 CAGTAGGTAGACCCGGGGAGGGG - Intronic
1139221944 16:65192184-65192206 AAGTAGTTTTCCATGGGGAATGG - Intergenic
1142763255 17:2053079-2053101 CAGTAAGTTAACTTGGGGAGCGG + Intergenic
1143281553 17:5758343-5758365 AAGCAGGTTGACATGGAGAGAGG - Intergenic
1145848464 17:28066158-28066180 CAGTAAGTTTACAGGGTAAGAGG - Intronic
1147357668 17:39910453-39910475 CAGTATCTTTACATGGAAAGTGG - Intronic
1148197156 17:45722228-45722250 CAGCAGGTCTTCATGGGGTGGGG + Intergenic
1150469060 17:65420672-65420694 CAATTTGTTTGCATGGGGAGAGG + Intergenic
1152381323 17:79943756-79943778 CAGTAGGTGTCCATGGGAAAGGG + Intronic
1153170962 18:2315105-2315127 CAGCAGGTGTCCCTGGGGAGTGG - Intergenic
1154485930 18:14871223-14871245 CAGTAGGTTTAGAGGGAGGGTGG - Intergenic
1156196123 18:34776080-34776102 CTGTAGGTTTAGAAGGGGAGTGG + Intronic
1167515871 19:49922888-49922910 CAGGGGGTTGACATGGGAAGAGG - Intronic
1168039299 19:53745403-53745425 CAGCAGGTTTAGGTGGGGGGCGG - Intergenic
926047716 2:9722185-9722207 GAGGAGTTTAACATGGGGAGAGG + Intergenic
928672248 2:33613498-33613520 CAGAAGCTATCCATGGGGAGAGG - Intergenic
929377437 2:41306208-41306230 TTGTAGTTTTACATGTGGAGTGG - Intergenic
929559553 2:42947406-42947428 GAGAATGTTTACATGGGAAGGGG + Intergenic
929657792 2:43751402-43751424 CAGTAAGTTTACAAGAGGATGGG + Intronic
931463186 2:62465847-62465869 CAGTACGTTTAGGTGGGTAGGGG + Intergenic
940143502 2:150521694-150521716 CGGTGGGTTTACAGGGGAAGTGG - Intronic
942121108 2:172778446-172778468 AAGTATATTTAAATGGGGAGGGG - Intronic
942316698 2:174702945-174702967 CTGTATGTTTACATGGCAAGGGG + Intergenic
945278163 2:208009283-208009305 CAGTAGGTTGAGGTGGGAAGAGG - Intronic
945745453 2:213714903-213714925 AAGTAGGTTTGAATGGAGAGAGG + Intronic
946694720 2:222343475-222343497 CAGTTGGTTATCTTGGGGAGTGG - Intergenic
947554778 2:231081974-231081996 CAGTAGGTTTACATGAGAAGGGG - Intronic
1170572235 20:17638946-17638968 CAGAGGGTTTACCTGGGGATGGG - Intronic
1171083304 20:22210852-22210874 CATTTTGTTTACATGGGTAGGGG + Intergenic
1172591054 20:36118168-36118190 CAGTAGATTTTCCTGGGGAAAGG - Intronic
1176795374 21:13368155-13368177 CAGTAGGTTTAGAGGGAGGGTGG + Intergenic
1180865068 22:19113698-19113720 CAGTAGGTTGACTTGGCAAGTGG - Intronic
1181433563 22:22897232-22897254 CAGCAGGTGTACATGGGATGGGG - Intergenic
1182041595 22:27242424-27242446 GCATAGGTTTACATGGGGACTGG + Intergenic
1183736252 22:39646460-39646482 CAGCAGGGAGACATGGGGAGAGG - Intronic
952233778 3:31458263-31458285 TAGTAGGTGTATATGGGGACAGG - Intergenic
952517677 3:34122293-34122315 CAGTAGCTTGGCAGGGGGAGGGG - Intergenic
955814567 3:62828181-62828203 CAGTAGATCTCCATGGGGAATGG - Intronic
957553449 3:81735969-81735991 TAGTAGGCTTAGATGTGGAGTGG - Intronic
962826183 3:139102488-139102510 CAGGAGGATTCCAAGGGGAGGGG + Intronic
963630117 3:147721810-147721832 CAGGAGGTTTCCCTGGGGATGGG - Intergenic
967804176 3:193700041-193700063 CATTAGGTATGCAAGGGGAGTGG - Intergenic
968174125 3:196534387-196534409 AAATATGTTTACATGTGGAGTGG - Intergenic
969317404 4:6390507-6390529 CTGGAGGGTGACATGGGGAGGGG - Intronic
971814147 4:31465464-31465486 CAGAAGCTATTCATGGGGAGTGG + Intergenic
978683916 4:111415877-111415899 GAGAAGGTTTTCCTGGGGAGAGG - Intergenic
978693957 4:111553372-111553394 GAAAAGGTTTACATGGCGAGTGG - Intergenic
983361088 4:166724252-166724274 CAAAAGGTCTTCATGGGGAGAGG - Intergenic
987802110 5:22712427-22712449 GAGTAGATTTAAAAGGGGAGAGG - Intronic
993170232 5:84410167-84410189 AGGTAGGTTTACTTGTGGAGGGG + Intergenic
994409322 5:99386889-99386911 CAGTAGATTTGCAGGGGGAGGGG - Intergenic
999231590 5:150065194-150065216 CAGCAGGCCTAGATGGGGAGGGG - Intronic
1000933464 5:167280563-167280585 CAGTTGGTTTCCATGGTGTGTGG + Intergenic
1002275952 5:178104600-178104622 CAGTAGGTTTAGAGGGAGGGTGG + Intergenic
1002724668 5:181286572-181286594 CAGTAGGTTTAGAGGGAGAGTGG - Intergenic
1003196662 6:3920730-3920752 CAGTGGGTGAACATGTGGAGGGG + Intergenic
1004893994 6:20128954-20128976 CTGTAGGTTCACATGGAGAGGGG + Intronic
1005249813 6:23931560-23931582 CCGTTGGTATACATGGGGATTGG + Intergenic
1007167855 6:39841224-39841246 CAGCAGGGTTCCAGGGGGAGGGG + Intronic
1008797861 6:55326723-55326745 CTGTAGGTTTACATGAGGAAGGG + Intergenic
1009795986 6:68468656-68468678 CAGTAGTTAAACATGTGGAGAGG + Intergenic
1011184852 6:84662810-84662832 AAGTAGCTTTTAATGGGGAGGGG - Intergenic
1013210025 6:107978498-107978520 CAGTACATGTACATGGGGATGGG + Intergenic
1014297761 6:119641413-119641435 CAGTAGTTTTACATGAGAAGAGG + Intergenic
1016312741 6:142751851-142751873 CAGCCGGTTTACATGGGAACAGG - Exonic
1018581459 6:165311554-165311576 AAGTAGGCTCACATGGGCAGCGG + Intergenic
1021922448 7:25499688-25499710 CAGTAGGTTTAAGTGAGAAGAGG - Intergenic
1023626360 7:42118985-42119007 CAGGAGGCTTATATGGAGAGTGG - Intronic
1024128006 7:46320574-46320596 CAGTAGGTACACATAGGAAGAGG + Intergenic
1026423955 7:70270857-70270879 TAATAGATTAACATGGGGAGAGG - Intronic
1028599045 7:92580792-92580814 AAGTATGTTTTAATGGGGAGAGG - Intronic
1029303665 7:99603216-99603238 CTGTGGGTTTAGGTGGGGAGAGG - Intronic
1036100377 8:5775714-5775736 CAGGAAGTATACATGAGGAGGGG - Intergenic
1036740125 8:11353735-11353757 AAGTAGGTTTTCTAGGGGAGTGG + Intergenic
1040310981 8:46236733-46236755 CCGCAGGTTTGCCTGGGGAGGGG + Intergenic
1041086133 8:54258308-54258330 CAGTAGCTGTACATGGCTAGTGG + Intergenic
1042407719 8:68424118-68424140 CAGTGGGTGAACATGGGCAGGGG - Intronic
1042874255 8:73426110-73426132 CAGTTTGTAGACATGGGGAGAGG - Intronic
1047709541 8:127538057-127538079 CAGTAGGAGTAAAGGGGGAGTGG + Intergenic
1048855309 8:138681736-138681758 CAGTGGGTATATATGGAGAGGGG - Intronic
1048946449 8:139452790-139452812 CAGTAGGTTTGCATAGCAAGTGG + Intergenic
1053463451 9:38288280-38288302 CAGTAGTTTTCCCTGGGTAGAGG - Intergenic
1053886844 9:42650044-42650066 CAGTAGGTTTAGAGGGAGGGTGG - Intergenic
1054225863 9:62457494-62457516 CAGTAGGTTTAGAGGGAGGGTGG - Intergenic
1058523658 9:105836413-105836435 CAGTGGGTCTACCTGGGGTGGGG + Intergenic
1058888013 9:109337512-109337534 CAGTAGGGTTAACTGAGGAGGGG + Intergenic
1060949019 9:127589098-127589120 CAGCAGGTATACATGGGCACTGG + Intergenic
1192965846 X:76175899-76175921 CAGAAGGCTTGGATGGGGAGTGG + Intronic
1194297152 X:92140994-92141016 CATTAATTTTACATGGGGATGGG + Intronic
1198300716 X:135331947-135331969 CTGTAGGATGAAATGGGGAGGGG + Intronic
1199037988 X:143076348-143076370 CAGTAGGTCTTTATGGGGGGTGG + Intergenic
1199417961 X:147608360-147608382 CATTAAGTTTATATGGGGGGCGG - Intergenic
1199852108 X:151732118-151732140 CAGGAGGTCTTCCTGGGGAGCGG - Intergenic
1200614671 Y:5365565-5365587 CATTAATTTTACATGGGGATGGG + Intronic
1200938291 Y:8757537-8757559 CAATAGGGTCAGATGGGGAGAGG - Intergenic
1201912183 Y:19143987-19144009 GATTTGGTTTCCATGGGGAGTGG + Intergenic