ID: 901596014

View in Genome Browser
Species Human (GRCh38)
Location 1:10385871-10385893
Sequence CAGGGTGCTCAGTTGGATCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901596014_901596020 15 Left 901596014 1:10385871-10385893 CCTAGATCCAACTGAGCACCCTG No data
Right 901596020 1:10385909-10385931 GCTGCCGACAGCTCAGTGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901596014 Original CRISPR CAGGGTGCTCAGTTGGATCT AGG (reversed) Intergenic
No off target data available for this crispr