ID: 901597020

View in Genome Browser
Species Human (GRCh38)
Location 1:10393313-10393335
Sequence TTCTAGTGTCCTTTTCTTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901597020_901597022 6 Left 901597020 1:10393313-10393335 CCTAAAAGAAAAGGACACTAGAA No data
Right 901597022 1:10393342-10393364 CTTGAATTCACCAGAAGGCATGG No data
901597020_901597024 25 Left 901597020 1:10393313-10393335 CCTAAAAGAAAAGGACACTAGAA No data
Right 901597024 1:10393361-10393383 ATGGAGCACTAGAATGATGAAGG No data
901597020_901597021 1 Left 901597020 1:10393313-10393335 CCTAAAAGAAAAGGACACTAGAA No data
Right 901597021 1:10393337-10393359 AATATCTTGAATTCACCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901597020 Original CRISPR TTCTAGTGTCCTTTTCTTTT AGG (reversed) Intergenic
No off target data available for this crispr