ID: 901597024

View in Genome Browser
Species Human (GRCh38)
Location 1:10393361-10393383
Sequence ATGGAGCACTAGAATGATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901597020_901597024 25 Left 901597020 1:10393313-10393335 CCTAAAAGAAAAGGACACTAGAA No data
Right 901597024 1:10393361-10393383 ATGGAGCACTAGAATGATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901597024 Original CRISPR ATGGAGCACTAGAATGATGA AGG Intergenic
No off target data available for this crispr