ID: 901598208

View in Genome Browser
Species Human (GRCh38)
Location 1:10401629-10401651
Sequence CAGAGAAAACTGAAAAATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 788
Summary {0: 1, 1: 0, 2: 7, 3: 62, 4: 718}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901598206_901598208 -5 Left 901598206 1:10401611-10401633 CCTGTAATCAGTTTCAGACAGAG 0: 1
1: 0
2: 0
3: 6
4: 134
Right 901598208 1:10401629-10401651 CAGAGAAAACTGAAAAATGGTGG 0: 1
1: 0
2: 7
3: 62
4: 718

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901598208 Original CRISPR CAGAGAAAACTGAAAAATGG TGG Intronic
900383932 1:2400709-2400731 CAGAGAAAACGAGAAAACGGGGG - Intronic
901598208 1:10401629-10401651 CAGAGAAAACTGAAAAATGGTGG + Intronic
904317369 1:29674287-29674309 CATAAAAGTCTGAAAAATGGAGG - Intergenic
904783374 1:32966993-32967015 CAAAGAAAACTGAAAAGCGGGGG + Intergenic
905100244 1:35514558-35514580 AAGGGAAAACTGAAAAAAGTAGG + Intronic
905206843 1:36347436-36347458 AATAGTAAACTGGAAAATGGAGG - Intronic
905254870 1:36673990-36674012 ATGAGAAAACTGAGATATGGAGG - Intergenic
905618617 1:39420567-39420589 CAGGGAACACTGAAAAAGGAAGG - Intronic
906722706 1:48020657-48020679 CAGATGAAACTGGAAAATGCTGG + Intergenic
907241460 1:53083563-53083585 CAGAGAAAACGGAAGACTGGAGG - Intronic
907376483 1:54047608-54047630 CAAAGAAAATGGAAAAAGGGTGG - Intronic
907590204 1:55659458-55659480 CAGAGAAAACAAAAAAAAGTAGG - Intergenic
907923039 1:58930894-58930916 CAGTGAAAAATGAAAATGGGGGG + Intergenic
908484626 1:64578466-64578488 AACAGAAAACTGGAAAATGCAGG - Intronic
908757888 1:67485785-67485807 CAGAGAAGACTCAAGAGTGGAGG + Intergenic
909023467 1:70457901-70457923 TAGAATAAACTGAAAACTGGTGG - Intergenic
909813476 1:79960378-79960400 AAGAGAAAACAGTAAAATGAGGG - Intergenic
909845265 1:80386092-80386114 CATAGAAAACTGAAATATATCGG + Intergenic
910462153 1:87459106-87459128 CAGAGGAAAGAGAAAAATTGAGG + Intergenic
910527813 1:88201251-88201273 CATAGAAAACTGAAGTAGGGAGG + Intergenic
910606600 1:89092104-89092126 CAGAGGAAAAAGAAAATTGGAGG + Intergenic
910855519 1:91691210-91691232 GAGAGAAAACAGAAAAAAGGGGG + Intronic
910922173 1:92359889-92359911 CAGAGAAAGCAGAAAAGGGGAGG + Intronic
911062075 1:93757333-93757355 CAGAGAAAAGAGAAAATGGGGGG - Intronic
912327683 1:108784475-108784497 TAGAGATAACTGAATCATGGGGG - Intronic
912327950 1:108786340-108786362 TGGAGATAACTGAATAATGGGGG - Intronic
912457292 1:109806640-109806662 CCTTGAAGACTGAAAAATGGTGG - Intergenic
912818966 1:112851643-112851665 CAGATAAAAATAAAAAATGGTGG + Intergenic
914320651 1:146556412-146556434 TAGAGCAAACTGAAGAAGGGTGG - Intergenic
914408293 1:147399797-147399819 AAGAGAAGACTTAAAAAAGGTGG - Intergenic
914799774 1:150952222-150952244 CAGAGTAATCTGAAAAAGGCAGG - Intronic
914806974 1:150998809-150998831 CAGAGAACAATGGGAAATGGGGG - Intronic
916398403 1:164417581-164417603 CAGAGATAATTGGAAAATAGTGG - Intergenic
916524347 1:165595374-165595396 CAGAGAAAATTGAAAAGAGCTGG - Intergenic
916736301 1:167609765-167609787 AAGAAAAAACTGGAAAATGTTGG + Intergenic
917471828 1:175332340-175332362 CAGAGAAAACTGCAAAAATGTGG - Intronic
917659087 1:177160248-177160270 TGGAGAAAACAGAAGAATGGGGG - Intronic
917813009 1:178678632-178678654 CACAGTGAACTGAAAATTGGAGG + Intergenic
917896669 1:179496669-179496691 CGTAGAAAACAGAAAAATTGTGG - Intronic
918748914 1:188245017-188245039 CAGAAATAAGTGAAAAAAGGAGG + Intergenic
918912529 1:190592166-190592188 CACAGAAAACTGAAAATGAGGGG - Intergenic
919075027 1:192803022-192803044 GACAGAAAACAGAAAATTGGTGG + Intergenic
919611911 1:199755922-199755944 CATATAAAACAGAAAAAAGGGGG + Intergenic
919965537 1:202520091-202520113 CTGAGCAAGCTGAAGAATGGAGG + Intronic
919987115 1:202683086-202683108 CAGAGAATACCAAAACATGGAGG + Intronic
920016566 1:202915203-202915225 AAGAGGAAACTGAAAATTAGTGG + Intronic
920022892 1:202968807-202968829 CAAATACAACTGAAAACTGGGGG - Intergenic
920067087 1:203276725-203276747 CAGAGAAATCTGAAGATTTGGGG + Intergenic
920707007 1:208258878-208258900 CAGAGAAAACTTAAGAACTGTGG - Intergenic
921259535 1:213373443-213373465 CATACATAACTGAAAAATGTAGG - Intergenic
921304506 1:213782334-213782356 CAGAGAAAACTAGGAAATGAAGG + Intergenic
921649304 1:217658040-217658062 CAGAGATAATTGAATCATGGGGG - Intronic
922071162 1:222194797-222194819 CAAAGGAGAATGAAAAATGGTGG - Intergenic
922366933 1:224874547-224874569 CAGTAAAAATTGAAATATGGAGG + Intergenic
922433577 1:225581135-225581157 CAGAAAAAAAAGAAAAATGTGGG + Intronic
922812822 1:228427173-228427195 CAGAGCAAGATGAAAAAAGGAGG - Intergenic
923168352 1:231389302-231389324 CAGAGTAAACTATAAAATGAGGG + Intronic
923239884 1:232073143-232073165 CAGAGAAAACCTAACACTGGAGG - Intergenic
923791871 1:237118525-237118547 CAGAGACAACGGTAGAATGGTGG + Intronic
923892018 1:238226614-238226636 GGGAGAAAACTGAATCATGGGGG - Intergenic
923950365 1:238944595-238944617 GAGAGATAATTGAATAATGGGGG + Intergenic
1063233857 10:4091935-4091957 TGGAGTAAACTGAAACATGGAGG - Intergenic
1063323041 10:5070130-5070152 CAGAGAAAACTGCAGAATTCTGG - Intronic
1063604454 10:7509854-7509876 TAGAGATAACTGAATCATGGGGG + Intergenic
1064291820 10:14041857-14041879 CAGAGAAAACTCAACTATGCTGG + Intronic
1064448371 10:15418063-15418085 GGGAGATAACTGAATAATGGGGG + Intergenic
1064530900 10:16308630-16308652 AAGAGAAAAGTGAAAAGTGAGGG + Intergenic
1064791815 10:18965443-18965465 CACATAAAACTGAAAAGTGGAGG + Intergenic
1064973407 10:21089047-21089069 CAGAGGAGACAGAAAAAGGGAGG + Intronic
1065263954 10:23955848-23955870 CACAGAAATCTGAAAGATGAAGG + Intronic
1065571661 10:27076744-27076766 TAGAGGAAACTGAAAAATTCCGG + Intronic
1065881984 10:30044795-30044817 AATAGAGAACTGAAAATTGGAGG - Intronic
1066292871 10:34029795-34029817 CAGAGAAAACAGAAAATAGCAGG + Intergenic
1067266516 10:44750077-44750099 CAGAGAAAGCAGAAAAATTGGGG - Intergenic
1068235304 10:54226350-54226372 GGGAGATAACTGAATAATGGTGG - Intronic
1068625379 10:59240663-59240685 CAAAGACAACAGAAATATGGAGG - Intronic
1068958307 10:62841322-62841344 CAGATAAAACTGAGAAATGATGG + Intronic
1069163203 10:65115665-65115687 CAGAGAAACTAGAAAAATAGAGG - Intergenic
1069468864 10:68668133-68668155 GAGAGAAAATAGATAAATGGAGG - Intronic
1070258155 10:74827584-74827606 CAGAGCAAACTTAAATATGAAGG + Intronic
1070637973 10:78144550-78144572 GAGAGAAGACTGGAACATGGTGG - Intergenic
1070980839 10:80645650-80645672 CAGAGAAGAATTAAAAACGGGGG - Exonic
1071366366 10:84904490-84904512 GAGAGAAAAGAGAAAAATGAAGG - Intergenic
1071997360 10:91162176-91162198 GAGGGGAGACTGAAAAATGGAGG + Intergenic
1072045557 10:91651167-91651189 CTGAGAAAACTGACAAGAGGTGG - Intergenic
1072458396 10:95597303-95597325 CAGACAATATTAAAAAATGGGGG + Intergenic
1074417376 10:113279037-113279059 CTGAGAAAACTCCAAAATGATGG - Intergenic
1074504115 10:114052644-114052666 CAGGGAAATCTGAAAAACTGAGG + Intergenic
1074751374 10:116590679-116590701 AATAGAAAACTGAAAAGTGAGGG + Intronic
1075297643 10:121292203-121292225 CAAAGAAAACAAAAAAAAGGGGG - Intergenic
1076273019 10:129172558-129172580 TAGAGAAATCTGGAAAGTGGAGG + Intergenic
1076436542 10:130449219-130449241 TAGAGAAAACAGAAAAAAGTTGG - Intergenic
1078572213 11:12469061-12469083 CAGGGAAAACGGATAAATGTTGG + Intronic
1079658081 11:23006798-23006820 GAGAGAACGTTGAAAAATGGAGG + Intergenic
1079923555 11:26462481-26462503 CAGAGAACACTGAAAAATGATGG - Intronic
1080264759 11:30389010-30389032 GAGAGAAAACTGAATAATTTAGG - Intronic
1080452257 11:32387799-32387821 GAGAGCAAAGTGAAAAATGCAGG + Exonic
1081222419 11:40477894-40477916 GAGAGATAACTGAATCATGGGGG + Intronic
1081322147 11:41704510-41704532 GAAAGAAAACTGAAGTATGGAGG - Intergenic
1081480438 11:43482147-43482169 AAGAGAAAACAAAAAGATGGTGG - Intronic
1081497346 11:43628450-43628472 CAAAGTAACCTGAAAAATTGGGG - Intronic
1081842630 11:46214201-46214223 AAGAGAAGACAGAGAAATGGAGG - Intergenic
1081861379 11:46335011-46335033 CAGAGACAAATCACAAATGGAGG + Intronic
1082134840 11:48535456-48535478 CAGATAAAACAGTAAAATGTAGG - Intergenic
1082184299 11:49161451-49161473 AATAGAAAACAGAAAAATGCAGG - Intronic
1083054172 11:59803813-59803835 GGGAGATAACAGAAAAATGGAGG - Intergenic
1084584267 11:70047733-70047755 CAGAAATATCTCAAAAATGGAGG + Intergenic
1085153937 11:74276135-74276157 CACTGGAAACTGCAAAATGGGGG + Intronic
1085548440 11:77343700-77343722 CACAGAAGACTCATAAATGGAGG + Intronic
1086000757 11:81983383-81983405 CAGAGAAGACAGAAAAAAGGAGG - Intergenic
1086111196 11:83200468-83200490 CCTAGAAAACTACAAAATGGAGG - Intronic
1086332119 11:85764479-85764501 CAGTGAAAGATGAAAAATAGTGG - Intronic
1086354859 11:85985248-85985270 CAAAGAAAACTGTAAAAAGTAGG + Intronic
1086562647 11:88186083-88186105 CAGAGGTAATTGAATAATGGGGG + Intergenic
1086682050 11:89683928-89683950 AATAGAAAACAGAAAAATGCAGG + Intergenic
1087083870 11:94197296-94197318 CAGAGATAATTGAATCATGGGGG + Intergenic
1087212002 11:95454192-95454214 CAGACAAAAAGGAAAAATGCTGG - Intergenic
1087511470 11:99101205-99101227 GAGAGATAACTGAATCATGGGGG - Intronic
1087944589 11:104143007-104143029 CACAGCTCACTGAAAAATGGAGG + Intronic
1088100320 11:106147154-106147176 CTGGGAAAACTGAGAAATGGAGG + Intergenic
1088434234 11:109793281-109793303 CAGACAAAAGTGAGAAATGGGGG - Intergenic
1089152124 11:116372299-116372321 TAGAGATAACTGAATCATGGGGG + Intergenic
1090629696 11:128635435-128635457 CAGAGACAATTGAATAATGGGGG - Intergenic
1090655409 11:128839893-128839915 CAGAGAAAACAGAAAAGCTGAGG + Exonic
1091076423 11:132622306-132622328 CAAAGACAACTGAAGAAAGGGGG + Intronic
1091296969 11:134480729-134480751 CAGAGAGAACAGACAGATGGGGG + Intergenic
1091415372 12:278267-278289 CAGAGTAAACTGACAGAGGGGGG + Intergenic
1091494559 12:961015-961037 CAAAGAAAATTGAAAAAGAGGGG + Intronic
1091940443 12:4475580-4475602 GAGAAAAACCTGAAAAATAGAGG - Intergenic
1093074023 12:14738840-14738862 CAGAAGAAACTGAACATTGGTGG - Intergenic
1094098895 12:26739840-26739862 CATAGAAAAGTGAACAATTGAGG - Intronic
1094280318 12:28730270-28730292 CAGAGAAAAGTGGAAAAGGGTGG - Intergenic
1094392694 12:29969737-29969759 CAGAGAAATTTAGAAAATGGCGG - Intergenic
1094404640 12:30103668-30103690 AACAGAAAACAGAAAAATAGAGG - Intergenic
1095427468 12:42092588-42092610 AAGAGAAAACAGACAACTGGGGG + Intronic
1095433932 12:42166951-42166973 ATAAGAAAACAGAAAAATGGTGG - Intronic
1095552956 12:43466076-43466098 CAGAGAAACCTGAAGGAAGGTGG + Intronic
1096438188 12:51613570-51613592 CATTGAAAACAGAAAAATAGAGG - Intronic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1097285061 12:57870717-57870739 CTGACAAAACTGGAAAATGAAGG - Intergenic
1097403715 12:59162251-59162273 GGGAGATAATTGAAAAATGGGGG + Intergenic
1097501221 12:60405887-60405909 CAGGACAAACTCAAAAATGGAGG + Intergenic
1098850172 12:75586950-75586972 AAGAGAAAATGCAAAAATGGGGG - Intergenic
1098870199 12:75808830-75808852 CGGAGAAAATTGAATCATGGAGG + Intergenic
1099543079 12:83939348-83939370 AAGAGAGAATTGAAAAAAGGAGG + Intergenic
1100387354 12:94115946-94115968 CAGAGAAATCTTAGAAAAGGAGG - Intergenic
1100730879 12:97467019-97467041 CAGAGAAAGCTGAGAAAAGAAGG + Intergenic
1101145728 12:101838867-101838889 CAGAGCAAACAGAATAAGGGGGG - Intergenic
1101180056 12:102206538-102206560 CAGAGAAAGCTGCAAAAGGAAGG - Intergenic
1102431013 12:112882858-112882880 TAGAGTAAAATGAAAAATGTTGG + Intronic
1102542735 12:113634461-113634483 CAGGAAAAACTGGAAAAGGGGGG - Intergenic
1102892504 12:116571318-116571340 CAGAGAAACCTGGCAAATGCTGG - Intergenic
1103241532 12:119417435-119417457 AAGAGAAAAAGGAAAAAGGGGGG - Intronic
1103336108 12:120190995-120191017 ATGAGAAAACTGAAGATTGGGGG - Intronic
1103787214 12:123441891-123441913 CAGATGAAAGTGAAGAATGGGGG + Intergenic
1104180174 12:126372211-126372233 CAAAGATAACTGAATCATGGGGG - Intergenic
1104595802 12:130119316-130119338 CAGAGAAAGCTCAAAAATGCAGG + Intergenic
1106964718 13:35048222-35048244 CACAGAAAACTGAAATTGGGAGG + Intronic
1107070378 13:36261968-36261990 AAGAGAAAACTAAAAAGTGTGGG - Intronic
1107156533 13:37173663-37173685 CAGAAAAAAAAAAAAAATGGTGG - Intergenic
1107663082 13:42659439-42659461 CAAAGAAAACTGAAAAAATAGGG - Intergenic
1108085886 13:46793008-46793030 CAGAGAAAACTGACAACTTGAGG - Intronic
1108223978 13:48268632-48268654 CAGAAAAAAATGATAAATTGTGG - Exonic
1108408976 13:50129259-50129281 CAGAGAAAAAAAAAAAAAGGTGG - Intronic
1108807648 13:54179562-54179584 AAGAGAAAACTGCTGAATGGGGG - Intergenic
1108852176 13:54744280-54744302 CACAGAAAAATGAATAGTGGAGG + Intergenic
1109434297 13:62278734-62278756 CAGAAAAAAATGACAAAAGGGGG - Intergenic
1109664892 13:65521257-65521279 CAGAGAAAAGTGAAAGACAGAGG - Intergenic
1109808666 13:67478344-67478366 TAGGGAAAACTGTAAAGTGGTGG - Intergenic
1109905067 13:68829906-68829928 CAGAGGTAATTGAATAATGGGGG + Intergenic
1110002512 13:70222233-70222255 AAGAGAAAAGTGAAAAATATGGG - Intergenic
1110473929 13:75891190-75891212 AAGAGATAACAGCAAAATGGTGG - Intergenic
1111123667 13:83884389-83884411 CAAGGAAAACAGAAAAATGCTGG + Intergenic
1111248955 13:85578430-85578452 CTGAGACCACTGAAAAATAGTGG + Intergenic
1111286895 13:86105818-86105840 CACAGAAAACAGAAAAAAGCAGG - Intergenic
1111544751 13:89718089-89718111 AAGAGAGAACTGAAAAATTAGGG - Intergenic
1111567933 13:90041226-90041248 CAGAGAAAAATGAAACATGAAGG + Intergenic
1111738053 13:92166773-92166795 TTGAGAAGACTGAATAATGGTGG + Intronic
1112229704 13:97576360-97576382 CAGAAAAAAATACAAAATGGTGG - Intergenic
1112295068 13:98179314-98179336 CAGAGATAACTGAATCATGGGGG - Intronic
1112582936 13:100691919-100691941 CAGAGATAAATGAATCATGGGGG + Intergenic
1112622992 13:101071077-101071099 CAGAGATAATTGAATCATGGGGG - Intronic
1112626164 13:101106604-101106626 CAGAGATAATTGAATCATGGGGG + Intronic
1112699810 13:101993761-101993783 CAGAGAAGGCAAAAAAATGGAGG + Intronic
1112718149 13:102210786-102210808 CAGAGAATATTGGAAAATGAGGG + Intronic
1112884311 13:104149578-104149600 CAAAGAAAACAAAGAAATGGAGG + Intergenic
1114318567 14:21527547-21527569 CTGATAAAACTGAGACATGGTGG + Intronic
1114820782 14:26016952-26016974 AAGAGAAAACAGAAAAATGTAGG + Intergenic
1114950158 14:27740344-27740366 CAGAAAAGACTGAAAATAGGAGG - Intergenic
1115103810 14:29735727-29735749 CAGAGAGAAATGAAATATAGAGG - Intronic
1115131532 14:30057762-30057784 CTGAGAAAACAGAAGAAAGGGGG + Intronic
1115364649 14:32544219-32544241 AAAAGAAAACTGAAAAGTGAAGG - Intronic
1115374942 14:32664435-32664457 TAGAGAAAACTGAAGAATATTGG + Intronic
1115710558 14:36046268-36046290 CAGAGGAAACGTAAAAATGCAGG + Intergenic
1115801536 14:36999765-36999787 CAAAGACAACTGAAAAGTTGGGG + Intronic
1116209567 14:41917439-41917461 CAGAGAAGACAGAGAAAAGGGGG - Intergenic
1116240801 14:42340045-42340067 AAGAGAAATATTAAAAATGGTGG - Intergenic
1116267504 14:42712599-42712621 GAGAGATAACTGAATCATGGGGG - Intergenic
1116347901 14:43819902-43819924 CAAAGAAAAATGAAAAGTGAAGG + Intergenic
1117122131 14:52579423-52579445 CAGAGAGAACTGAGAAGTGGGGG - Intronic
1117481375 14:56148666-56148688 CAGAGAACACAGAAGAAAGGAGG - Intronic
1117512432 14:56466366-56466388 CCAAGAAACCTGAGAAATGGGGG + Intergenic
1118065409 14:62185322-62185344 CAGAGAAATCTGAACACTGCTGG + Intergenic
1118191787 14:63587429-63587451 CAGAGAAACCCTTAAAATGGGGG + Intergenic
1119550569 14:75509759-75509781 CAAAGAAGACTAAAAAATAGTGG + Intergenic
1119992548 14:79215658-79215680 GGGAGATAACTGAATAATGGGGG - Intronic
1120421854 14:84297129-84297151 CAGATAAAACTGAGAATGGGAGG - Intergenic
1120652401 14:87150494-87150516 CAAAGGAAACTGAGAAATAGAGG + Intergenic
1120807748 14:88771736-88771758 CAAACACTACTGAAAAATGGAGG - Intronic
1120993652 14:90398426-90398448 CAGAGAAAGCAGAAACGTGGAGG - Intronic
1121911740 14:97798025-97798047 CACAGAAAACTGAAGTAGGGGGG - Intergenic
1123970487 15:25503964-25503986 GACAGAAAAATGAAAAAAGGAGG - Intergenic
1124444872 15:29721680-29721702 AAGAGAAGACAGAAAAATGAGGG + Intronic
1124454771 15:29831830-29831852 AAGAGAAAAATAAAAAATAGAGG + Intronic
1125325551 15:38532894-38532916 GAGAGAAAACTGGCAAAGGGTGG + Intronic
1125442668 15:39719844-39719866 CACAGTAATCTGTAAAATGGAGG + Intronic
1125517183 15:40328194-40328216 CAGTGAAAACTGAAAAAACAAGG - Intergenic
1126316491 15:47375397-47375419 AAAAGAAAATAGAAAAATGGAGG - Intronic
1126354920 15:47784964-47784986 CAGAGCCAACTGAAATATGTTGG - Intergenic
1126491666 15:49243637-49243659 CAGAGAAAACAGGAAACTAGAGG + Intronic
1126522373 15:49610612-49610634 TATAGAAAACAGAAAAAAGGTGG - Intronic
1126615351 15:50573385-50573407 CAGAGAACACTGAAGAACTGAGG + Intronic
1126631692 15:50742860-50742882 TTGAGAAAATTGAAAATTGGAGG - Intronic
1126808542 15:52378090-52378112 CAGAGGAGGCTGAAAGATGGAGG - Intronic
1127443542 15:59036577-59036599 CAGAGATAACTGAATCATGGGGG - Intronic
1127839763 15:62820942-62820964 AAGAGAAACCAGAAAATTGGAGG - Intronic
1128166889 15:65473402-65473424 GAAAGAAAACTGATAAATGTAGG + Intronic
1130075348 15:80684169-80684191 GAGAGATAACTGAATCATGGGGG + Intronic
1130330154 15:82916134-82916156 CAGAGGAAACAAAATAATGGGGG + Intronic
1130748470 15:86683122-86683144 CACAAAAAACTGACAGATGGGGG + Intronic
1131329593 15:91484771-91484793 GAGAGACATCTGAAAAAGGGGGG + Intergenic
1131427506 15:92358541-92358563 CAGAGATAATTGAATCATGGTGG - Intergenic
1132308786 15:100840172-100840194 AAGAGAAGACTAAAATATGGGGG + Intergenic
1132341258 15:101079724-101079746 CATAGACAGCTGAAAAATGCTGG - Intergenic
1133124026 16:3633215-3633237 CAGAGAAAGCAGAAAAAGAGTGG - Intronic
1133534781 16:6691353-6691375 CAGAGAAGAGTGAAGAATGATGG - Intronic
1134140125 16:11711212-11711234 CAGAGAAAACAGAGTAAGGGTGG + Intronic
1134569381 16:15278459-15278481 CAGAGAGAAGAGGAAAATGGAGG - Intergenic
1134934442 16:18234387-18234409 CAGAGAGAAGAGGAAAATGGAGG - Intergenic
1135206618 16:20490382-20490404 CAGAGAAAAGGGACAAAGGGTGG + Intergenic
1135212268 16:20533250-20533272 CAGAGAAAAGGGACAAAGGGTGG - Intergenic
1135246961 16:20865207-20865229 AAGAAAAAACTGAAAAAAGTGGG + Intronic
1135387826 16:22059725-22059747 TAGAGGAAACTGAATCATGGGGG - Intronic
1135507225 16:23049492-23049514 TGGAGAAAACTGAATCATGGGGG + Intergenic
1135872088 16:26160590-26160612 CAGAGGAAATTGAAAACTGAAGG - Intergenic
1136287062 16:29250571-29250593 GGGAGAAAACTGAACCATGGGGG + Intergenic
1136648570 16:31645362-31645384 CAGAGGAGACTGAAGAATGAGGG + Intergenic
1138717485 16:59040580-59040602 AAGAGAAAACAGAAAACTGAGGG + Intergenic
1140012882 16:71153693-71153715 TAGAGCAAACTGAAGAAGGGTGG + Intronic
1140080441 16:71741866-71741888 CAAAGAAAAGTGAAAATTTGAGG - Intronic
1140225150 16:73071030-73071052 CTGAAAAAACTGAAAAGCGGGGG - Intergenic
1140748766 16:78004472-78004494 CAGATAAATCTGAAAGAGGGTGG + Intergenic
1140892513 16:79297302-79297324 CAGAGAAAATAGCAAAACGGCGG + Intergenic
1141341815 16:83210461-83210483 AAGAGAAATCAGAAACATGGAGG + Intronic
1141433006 16:83980610-83980632 CCGAGAAAACAGAACAAGGGTGG + Intronic
1142092666 16:88223203-88223225 GGGAGAAAACTGAACCATGGGGG + Intergenic
1143441958 17:6981804-6981826 AAAAGAAAACTGAAAAAAGAGGG - Intronic
1144036797 17:11373783-11373805 CAGAGAAAAGTCATAAATAGTGG - Intronic
1144328164 17:14201706-14201728 CAGTGATAACTTAGAAATGGGGG - Intronic
1144686595 17:17230016-17230038 CAGAGAAGGCTTTAAAATGGGGG + Intronic
1145392656 17:22467835-22467857 GAGAGAGAACTGAAGAAGGGTGG - Intergenic
1148029730 17:44611174-44611196 AATAGATAACTGAAAAATGAAGG - Intergenic
1148971056 17:51482103-51482125 CAGAAAAAATAGAAAAATGCTGG + Intergenic
1149420816 17:56509551-56509573 CAGGGGAAGCTGAAAAAAGGCGG + Intronic
1149484951 17:57035340-57035362 CAAAAAATACAGAAAAATGGTGG - Intergenic
1149654663 17:58303835-58303857 TAGAGAAAACTGAGAGTTGGAGG + Intronic
1150576933 17:66438858-66438880 CAGAGATAATTGAATCATGGGGG - Intronic
1150688777 17:67344636-67344658 CAGAGGAAGGTGAAAAAAGGTGG - Exonic
1151072910 17:71236580-71236602 CAGAGATGAATGAAAAATAGAGG - Intergenic
1151084866 17:71368392-71368414 CAGTGCAAAATGAAAAATGCAGG - Intergenic
1153684417 18:7530951-7530973 CAGAGACAACTGAAACATGGAGG - Intergenic
1154284083 18:13035518-13035540 GGGAGATAACTGAAACATGGAGG - Intronic
1154350299 18:13577535-13577557 CAGAGAAAACTTAAGAAATGGGG + Intronic
1154390009 18:13928497-13928519 CAAAGAAAACTTAAAAATGACGG + Intergenic
1155388472 18:25307480-25307502 CAGAGCAGTCTGAAAAATGCAGG + Intronic
1155442789 18:25879711-25879733 CAGATAAAAATGAAAACTCGTGG - Intergenic
1155679569 18:28473411-28473433 TAGAGAAGACAGAAAAATGTGGG + Intergenic
1156043387 18:32850127-32850149 CACTGAAAACTGCAAAATGTTGG + Intergenic
1156145287 18:34167986-34168008 CAGAAAAAAATGTAAAATGCAGG - Intronic
1156366925 18:36438127-36438149 CAGAGAAAACTTGACAATAGAGG + Intronic
1157864527 18:51169280-51169302 GAGAGAAAAATCAAGAATGGGGG - Intergenic
1157981249 18:52383690-52383712 CAGAGAAACCAGGAAAATGAAGG - Intronic
1157990625 18:52491651-52491673 CAATGAAGACAGAAAAATGGAGG + Intronic
1158083695 18:53625335-53625357 CAGAGAACACTGAAAAATTCAGG - Intergenic
1158854754 18:61531717-61531739 TAGAGATAACTGAATCATGGGGG + Intronic
1159084649 18:63774844-63774866 CAGAGAAAATTGAGAAAAAGAGG + Intronic
1159765087 18:72479770-72479792 GAGAGATAACTGAATCATGGGGG + Intergenic
1159850423 18:73520667-73520689 CATAGATAACTGAATCATGGGGG + Intergenic
1159867426 18:73722774-73722796 GAGAGATAATTGAATAATGGGGG - Intergenic
1160290977 18:77593325-77593347 CAGAGAAAATGGAAAGTTGGAGG - Intergenic
1162243740 19:9381206-9381228 AAGGGAAGACTGAAAAATGAAGG - Exonic
1162450439 19:10751104-10751126 CAGAGAAAAATGAGGCATGGGGG + Intronic
1164486545 19:28660902-28660924 GGGAGAAAACTGAATCATGGGGG + Intergenic
1164550890 19:29211786-29211808 CAGAGTAAAAAGAAAAGTGGCGG + Intronic
1165174484 19:33917584-33917606 CAGAGATAATTGAATCATGGGGG + Intergenic
1165260314 19:34609763-34609785 CTGAGAAAAATGAAAAAAGTTGG - Intronic
1165268595 19:34683343-34683365 CAGATAGAAATGAAAAATTGAGG + Intronic
1165274853 19:34739736-34739758 CAGATAGAAATGAAAAATTGTGG + Intronic
1166573684 19:43816781-43816803 GAGAGATAACTGAATCATGGGGG + Intronic
1167216427 19:48168613-48168635 GAGAGAAGACTGGAAACTGGTGG + Intronic
1167321672 19:48800386-48800408 CACAGACAACTGAAAGATGGAGG + Intronic
1167961465 19:53107595-53107617 CAGAGAATAATGCAAAATGATGG - Intergenic
1168679024 19:58300378-58300400 CAGTGAAGACTGAAAGAAGGGGG + Exonic
925234583 2:2266716-2266738 GAGAGATAATTGAAACATGGGGG + Intronic
925457928 2:4033140-4033162 CAAAGAAAAATGAAATATGTAGG - Intergenic
925805331 2:7642694-7642716 CAAGGAAAACTGAGAAATGTAGG + Intergenic
926969782 2:18454931-18454953 CAAAGTAAACTGAAAAGTAGAGG - Intergenic
927116218 2:19904687-19904709 GAGAAAAAACTGAATCATGGGGG - Intergenic
928105754 2:28469600-28469622 GATAGAAAACTGAAGAATTGAGG - Intronic
928254152 2:29707430-29707452 CAGGGAAAACAGAACAAGGGAGG + Intronic
929943908 2:46356137-46356159 CAGAGCAAACTGGAAAGGGGGGG - Exonic
929955926 2:46458689-46458711 GTGAGAAAACTGAAATCTGGAGG + Intronic
930300871 2:49613935-49613957 CAGAGCATACTGGATAATGGGGG - Intergenic
930534101 2:52626127-52626149 CAGGGAAACCTGGAACATGGAGG + Intergenic
930546177 2:52769948-52769970 AAGAGAAAACAGAAAAACGCAGG + Intergenic
930625257 2:53689788-53689810 AAAAGAAAAATGAAAAATGAAGG - Intronic
931784987 2:65610562-65610584 CAGGGAAGACAGACAAATGGAGG - Intergenic
931992582 2:67805443-67805465 GAAAGAAAGCAGAAAAATGGGGG + Intergenic
932119671 2:69087085-69087107 CAGAGGAAACTGAGATTTGGAGG + Intronic
932155984 2:69418096-69418118 GAAAGAAAACTGAAGAATGGGGG + Intronic
932551639 2:72775912-72775934 CATAGAAAACTGAATAATGTAGG + Intronic
932711717 2:74070409-74070431 GAGAGATAACTGAATCATGGAGG - Intronic
933209561 2:79551299-79551321 AAGAGGAAATGGAAAAATGGGGG + Intronic
933326236 2:80841515-80841537 CAGAGTATTCTGAAAAATAGAGG - Intergenic
933423834 2:82085831-82085853 CAGAGACAACTGAATCATGGGGG - Intergenic
933523055 2:83398965-83398987 GAGAAAGAACTGAAAAATAGAGG + Intergenic
933595691 2:84280904-84280926 AAGTGAAATCTGACAAATGGAGG + Intergenic
933714121 2:85347901-85347923 CAGTGCAAAATGAAAAATGAAGG - Intronic
934882025 2:97991493-97991515 AATAAAAAACTGAAAACTGGAGG + Intronic
935213973 2:100961603-100961625 CAGATAAAACTGCATTATGGGGG + Intronic
935447252 2:103169686-103169708 CAGAGAGACTTGAAAAATGGGGG - Intergenic
935461529 2:103341483-103341505 GTGAGAAAACTGTAAAATCGTGG + Intergenic
936226938 2:110663502-110663524 CAGAGAAGTTTGAAAAAGGGAGG + Intronic
937142286 2:119612517-119612539 TAGAGATAACTGAATCATGGGGG - Intronic
937553938 2:123131255-123131277 GGGAGATAACTGAATAATGGGGG + Intergenic
939196640 2:138981061-138981083 TAGAGACAACTGCAAAAAGGGGG + Intergenic
939522764 2:143252138-143252160 CAGAAGAAACTGAAAAAGGCTGG - Intronic
939682525 2:145156204-145156226 AAGAGAAAACTGAACACTGTGGG - Intergenic
939730345 2:145776991-145777013 CAGAGAAAATTTAAAAAGGAAGG + Intergenic
939774757 2:146370823-146370845 CTGAGAAAACTGGGAAGTGGGGG + Intergenic
939827280 2:147029998-147030020 CTGAGAAAATTGAAAATTGAGGG + Intergenic
940309937 2:152267837-152267859 AAGAGATAACTGAATCATGGGGG + Intergenic
941059111 2:160826212-160826234 CAGAGAAAAATGAGAATAGGAGG - Intergenic
941137813 2:161739232-161739254 CAGATTAACCAGAAAAATGGAGG + Intronic
941143230 2:161811429-161811451 AGGAGAAAATGGAAAAATGGAGG - Intronic
941388707 2:164885147-164885169 AAAAGAAAACTGATAAAAGGGGG - Intergenic
941404026 2:165066689-165066711 TAGAGAAAACAGAAAAAGGAAGG + Intergenic
942391393 2:175497399-175497421 CTGAGAAAAAAGAAAATTGGAGG - Intergenic
942494663 2:176527121-176527143 CAGAGAAAAGAGGAAAAAGGAGG - Intergenic
943204905 2:184882109-184882131 AAGAGAAAACAGAAAAAAGCAGG + Intronic
943232362 2:185271163-185271185 CAGAAAAACATGAAAAAGGGAGG + Intergenic
943622620 2:190167313-190167335 GAGAGGTAACTGAAACATGGGGG - Intronic
943812153 2:192200514-192200536 AAGAAAAAATAGAAAAATGGAGG + Intergenic
944333229 2:198497550-198497572 CAGAAAACACTGAAATTTGGGGG - Intronic
944571190 2:201045608-201045630 AATAGAAAACTGAAATATTGAGG + Intronic
944761399 2:202818584-202818606 GAGAGATAACTGAATCATGGGGG + Intronic
945145777 2:206736554-206736576 GGGAGATAACTGAAACATGGGGG - Intergenic
945376775 2:209086296-209086318 TCGAGAAAACTGAAATATGAAGG - Intergenic
945588881 2:211702863-211702885 GACAGAAAATTGAAAAATCGAGG + Intronic
945774252 2:214084685-214084707 CAGAGTAAGCTGATAAATTGGGG - Intronic
946157436 2:217816252-217816274 CAAAGAAAACACAAAAAGGGAGG + Intronic
946585887 2:221187295-221187317 GAGAGAGACCTGAAAAGTGGAGG + Intergenic
946647826 2:221857483-221857505 AAGAGAAAATAGAAAAATGAAGG + Intergenic
946952920 2:224897006-224897028 CAAAGGAAGCTGAAAAATGATGG - Intronic
947102930 2:226640593-226640615 CTGAAAAAACTGAAGAATTGTGG + Intergenic
947443590 2:230145072-230145094 GAGAGAAAACTGCACATTGGTGG + Intergenic
947474720 2:230432998-230433020 CAGTGAAAAATGAAAATGGGGGG + Intronic
947776426 2:232714700-232714722 CACAGAAAACAGAACAGTGGTGG - Intronic
948738647 2:240027454-240027476 GAGGGAAAACGGAAAAAGGGGGG - Intergenic
949030173 2:241791978-241792000 AAAAGAAAACAGAAAAATGGGGG - Intronic
1169188942 20:3644844-3644866 CACAGAACAATGAAAATTGGTGG - Intronic
1170218174 20:13914252-13914274 CTGAGTAAAGTGAAAAATTGAGG + Intronic
1170404973 20:16026302-16026324 CAGTGAATACAGTAAAATGGTGG - Intronic
1170508453 20:17053188-17053210 CGGAGATAACTGAATCATGGGGG - Intergenic
1170750218 20:19138749-19138771 CAGAGATAATTGAAACATGGAGG - Intergenic
1170754631 20:19188960-19188982 GAGAGGTAATTGAAAAATGGGGG + Intergenic
1171112474 20:22496657-22496679 CAGAGAAAACTCATCTATGGTGG + Intergenic
1171293465 20:23995751-23995773 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1172127404 20:32633064-32633086 TAGAGATAATTGAATAATGGTGG - Intergenic
1172452586 20:35038028-35038050 CAGAGAAAAAAGCAGAATGGTGG + Intronic
1173072918 20:39786725-39786747 GAGAGATAACTGAATCATGGGGG - Intergenic
1173131233 20:40395616-40395638 GAGAGAAAACAGAAGATTGGAGG + Intergenic
1173254341 20:41383247-41383269 AGGAGACAACTGAAACATGGGGG + Intergenic
1173322453 20:42000633-42000655 CACAGAAAACATAAAAATGCAGG - Intergenic
1173948418 20:46970242-46970264 CAGAGAAATTTTCAAAATGGTGG - Intronic
1174749704 20:53099781-53099803 CAGAGACAATTGAATCATGGGGG - Intronic
1177035670 21:16039460-16039482 TAGAGAAAATTGAATCATGGGGG - Intergenic
1177387023 21:20421866-20421888 CAGAGAGAATTCAAAATTGGAGG - Intergenic
1177493446 21:21857915-21857937 TAGAGAATAGTGACAAATGGGGG + Intergenic
1177742296 21:25168640-25168662 GAGAGATAACTGAATCATGGGGG + Intergenic
1177771001 21:25515720-25515742 AATAGAAAACTGACATATGGAGG - Intergenic
1177923469 21:27183959-27183981 GAGAGAAAACTCAAGATTGGTGG + Intergenic
1177943313 21:27437554-27437576 CAGAGATAGCTGAGAAATGGTGG - Intergenic
1178266605 21:31148279-31148301 GAGAGGTAACTGAATAATGGAGG + Intronic
1179393092 21:41011557-41011579 CAAAGAAAACTGAAAAGTTATGG - Intergenic
1179409591 21:41152443-41152465 TAGAGAAAACTGAATCATGGGGG - Intergenic
1179538219 21:42066192-42066214 CAGAGACAAATTAAAAATAGAGG + Intronic
1180824521 22:18853467-18853489 CAAAGAAAACAGAAGCATGGAGG - Intronic
1181124943 22:20696622-20696644 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1181188214 22:21121081-21121103 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1181210982 22:21289412-21289434 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1181398518 22:22637476-22637498 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1181650897 22:24258584-24258606 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1181706484 22:24652155-24652177 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1181785349 22:25222573-25222595 CACAGAAAAATGAAAAATGGGGG + Intronic
1181901252 22:26157972-26157994 CAGAGAAAGCTGAGAAATGCAGG - Intergenic
1181963789 22:26642538-26642560 GAGAGAGAAGAGAAAAATGGAGG + Intergenic
1182730188 22:32483093-32483115 CAGAGGACACTGAGAAATGCAGG - Intronic
1182873344 22:33667997-33668019 GCAAGACAACTGAAAAATGGCGG - Intronic
1183037044 22:35148329-35148351 CTGAGAAAACGGAAAACTGAAGG - Intergenic
1183753262 22:39734748-39734770 CAGAGATTAGTTAAAAATGGGGG - Intergenic
1184084869 22:42255077-42255099 ACGAGAAAACTGAATAACGGAGG - Intronic
1185211692 22:49574184-49574206 CAGAGAAAACTGGAGAGTGATGG + Intronic
1203215964 22_KI270731v1_random:6018-6040 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1203274659 22_KI270734v1_random:79372-79394 CAAAGAAAACAGAAGCATGGAGG - Intergenic
949690706 3:6634558-6634580 TATAGAAAAGTGAAAAATGAAGG - Intergenic
949691194 3:6641612-6641634 CTGAGGAAACTGAAAAATAGAGG - Intergenic
949725768 3:7042515-7042537 CAGAGAAAAAGAAAGAATGGGGG - Intronic
950366280 3:12486715-12486737 CAGGGAAAAGTGGGAAATGGGGG - Intronic
950991184 3:17439995-17440017 CTGAAAGAACTGAAAAATGCTGG - Intronic
951253029 3:20416290-20416312 CAGAGAAATATGGAAAATGTGGG - Intergenic
951291741 3:20879087-20879109 CAGATAAAAGTGAATAATAGTGG - Intergenic
952460666 3:33522188-33522210 AAGAGAAAAATGAAAAAGGAGGG - Intronic
952508768 3:34033537-34033559 CAGATAAAAATTAATAATGGGGG - Intergenic
952748974 3:36809062-36809084 CAGAGAAGACTGAACAAAGAAGG + Intergenic
953373846 3:42412381-42412403 CAGAGAAGACTGTAAAATTGTGG - Intergenic
953656841 3:44861390-44861412 CACAGAAAACCGAAAAAATGAGG - Intronic
956295672 3:67710758-67710780 CCAAGATAACTGAAAACTGGTGG + Intergenic
956757719 3:72405602-72405624 CAGGGAAAGCTGTAAATTGGAGG - Intronic
956825330 3:72992651-72992673 AAAAGAAAACTGAAATATAGAGG - Intronic
956952202 3:74295692-74295714 CAGAGACAACTGAAATGTGGTGG + Intronic
957115458 3:76018893-76018915 CAGAGAAAACCGAACCATGTGGG - Intronic
957115493 3:76019253-76019275 CAGAGAAAACTTAACCATGTAGG - Intronic
957115503 3:76019343-76019365 CAGAGAAAACCGAACCATGTGGG - Intronic
957115521 3:76019523-76019545 CAGAGAAAACTGAACCATGTGGG - Intronic
957115546 3:76019793-76019815 CAGAGAAAACCTAAACATGTGGG - Intronic
957115567 3:76019973-76019995 CAGAGAAAACCGAAGCATGTGGG - Intronic
957737929 3:84226199-84226221 GAGAAAAAAATGAAAAATGATGG + Intergenic
958151852 3:89702083-89702105 CAGAGATAATTGAATCATGGGGG - Intergenic
958466136 3:94461287-94461309 CAGAGAAACGTTAACAATGGAGG - Intergenic
958744443 3:98115134-98115156 TACAGAATACTCAAAAATGGAGG - Intergenic
959315730 3:104804118-104804140 CAGACAAAACTGTCAAATGAAGG - Intergenic
959746417 3:109780539-109780561 TAGAGAACCCTGAAAAATAGAGG - Intergenic
959986113 3:112572961-112572983 CTGAGAAAACCTTAAAATGGTGG + Intronic
960922871 3:122765975-122765997 CATATGAAACTGAAAAAGGGAGG - Intronic
960927244 3:122806975-122806997 CATAATAAAATGAAAAATGGGGG - Intronic
961344028 3:126249829-126249851 CAGAAAAAAATTAAAAATAGAGG + Intergenic
962623306 3:137199881-137199903 GAGAGAAAAGAGAAAAATTGAGG - Intergenic
962672402 3:137722412-137722434 CAGAGAAAGCTGAAAAGTGAAGG - Intergenic
963262223 3:143204505-143204527 CAGAGAAGAGTGAAAAATTGGGG - Intergenic
963277486 3:143347403-143347425 CAAAGGAAACAGATAAATGGAGG + Intronic
963333875 3:143949005-143949027 GAGAGAAAATTTCAAAATGGTGG - Intergenic
963388192 3:144623264-144623286 CAGAGTAAGCTGGAAAAGGGTGG + Intergenic
963550671 3:146718065-146718087 AAGAGTAAAATGTAAAATGGTGG - Intergenic
963705114 3:148677188-148677210 GACAGAAAACTGACACATGGGGG + Intergenic
964303270 3:155312355-155312377 CAAAGACAACTAAGAAATGGTGG - Intergenic
964673401 3:159251391-159251413 CAGGGAAATATGATAAATGGAGG - Intronic
964714484 3:159707671-159707693 CAAAGAAAAATGAAAAATTATGG - Intronic
964806388 3:160614203-160614225 CTGAGAAAAGTTAAATATGGTGG - Intergenic
964908403 3:161747228-161747250 AATACAAAACTGAAAACTGGAGG + Intergenic
965305424 3:167058510-167058532 TAGAGATAACTGAATCATGGTGG - Intergenic
965717475 3:171621804-171621826 CAGAAAAGACTTAAAAAAGGAGG - Intronic
965835159 3:172843099-172843121 CAGGGGAAACTGAGACATGGCGG - Intergenic
966141538 3:176762619-176762641 AAGAGAAAACAGAAAAAAAGGGG + Intergenic
966703384 3:182882053-182882075 CAGAGCAAAATGAAAAGTGTGGG + Intronic
967115604 3:186334726-186334748 CTGAGGAAACTGAAACACGGAGG + Intronic
967564777 3:190960339-190960361 TAGAGATAATTGAAATATGGGGG + Intergenic
967900566 3:194446994-194447016 CAGAGAAGACTGAAAAAAATCGG - Exonic
967978905 3:195053567-195053589 AAGACAAAAGTGAAAAATAGGGG - Intergenic
968686739 4:1964727-1964749 AAGAGAAAAATGAAAGAGGGGGG - Intronic
969890739 4:10257479-10257501 CAGAGAAGACTGAAATCTTGAGG - Intergenic
970187050 4:13467697-13467719 CAGAGAAAGCAGAAAAAGAGGGG + Intronic
970280478 4:14449431-14449453 CAGAAAAAAATAAAAAAGGGAGG + Intergenic
970670457 4:18390929-18390951 AAGAGAGAACTAAAAAATTGTGG + Intergenic
970739486 4:19217793-19217815 TGGAGAAAACTGAATCATGGGGG + Intergenic
971509467 4:27406185-27406207 CAGAGAAAAATGTAAAATTGTGG + Intergenic
971597092 4:28543974-28543996 TAGAGAAAAGTCAAAAAGGGAGG + Intergenic
971977022 4:33703383-33703405 CAGAGGCAACTGAATCATGGGGG + Intergenic
972002808 4:34059665-34059687 CAGAGGTAATTGAATAATGGGGG - Intergenic
972063564 4:34910942-34910964 GAGAGAAAAATGAATCATGGGGG + Intergenic
972696729 4:41453860-41453882 CAGAGAAATGAGATAAATGGAGG - Intronic
973083345 4:46023481-46023503 TAGAGAAAAATGAATTATGGAGG + Intergenic
973104016 4:46309248-46309270 AAAAGAAAACGGAAGAATGGTGG - Intronic
973321250 4:48812473-48812495 CAAAGGAAACTGAAAAAGAGTGG + Intronic
973636521 4:52866203-52866225 AAGAGAAAAAAGAAAAAAGGGGG - Exonic
973887338 4:55336629-55336651 CTGTGATAACTGAAAAATGTGGG + Intergenic
974192489 4:58524364-58524386 CAGGGATACCTGAAAAAGGGTGG + Intergenic
974193900 4:58543872-58543894 CAGGGAAAAAGTAAAAATGGAGG + Intergenic
974256373 4:59460158-59460180 AAAAGAAAACCTAAAAATGGAGG - Intergenic
974660550 4:64882791-64882813 CTGAGAAAACTGTAAAAGTGAGG + Intergenic
974685480 4:65222205-65222227 CATGGAAAACTGAAAAATAATGG - Intergenic
975304491 4:72833531-72833553 CTGAGAAAAGTAAGAAATGGGGG - Intergenic
975438928 4:74387696-74387718 GTGAGAAATCTGTAAAATGGGGG - Exonic
975804176 4:78095762-78095784 CAGAGATAACTGAATCATGGGGG - Intronic
976306137 4:83561129-83561151 TAGAGAAAACAGCACAATGGGGG + Intronic
976320981 4:83715300-83715322 CAGAGAGAACTAAAAAATATTGG - Intergenic
976398349 4:84582110-84582132 AAGAGAAAAAAGAAAAAAGGCGG - Intergenic
976959179 4:90945933-90945955 GAAAGAAAACTGAAATATAGAGG + Intronic
977131768 4:93248520-93248542 CAGAGAAAGCAGAAAATTTGAGG - Intronic
977377858 4:96230301-96230323 CAGAGAAGGAAGAAAAATGGTGG + Intergenic
977439860 4:97051247-97051269 CAGGGAAAACTGAAACTTTGAGG + Intergenic
977783216 4:101003814-101003836 CAAAGAAAAATGAAGAGTGGAGG - Intergenic
978246924 4:106584128-106584150 AAGAGAAAACTGAGAAAATGGGG + Intergenic
978291885 4:107151784-107151806 CTGAGGAAAGTGAAAAACGGTGG + Intronic
979384063 4:120042865-120042887 CAGAAAAAACAGAAAAATGAAGG - Intergenic
979783337 4:124683804-124683826 AAAAGAAAAATGACAAATGGTGG - Intronic
979833531 4:125331069-125331091 AAGAGAAAAACGAAAACTGGAGG - Intronic
979866067 4:125754923-125754945 CATATAAAACTGAAACTTGGTGG - Intergenic
979935001 4:126682262-126682284 CAGAGAAAACTGATGTATTGAGG + Intergenic
980196804 4:129599917-129599939 CAGAGAAAACCAAGAAAGGGAGG - Intergenic
980225961 4:129986044-129986066 CAGAAAAATCTGAAAAATAATGG + Intergenic
980305721 4:131059375-131059397 CATAGAAAACTGAGGAAAGGGGG - Intergenic
980567362 4:134561035-134561057 CAGAGAAATCCTAAAACTGGAGG - Intergenic
980664349 4:135909698-135909720 CAGAAAAAAATGCAAAAAGGAGG - Intergenic
980688203 4:136257661-136257683 CAGAAAAATCTTACAAATGGTGG + Intergenic
980753087 4:137117976-137117998 CAGACTAATCTGAAAAATAGAGG + Intergenic
980847386 4:138340432-138340454 TGGAGAAAAGTGAAAAATGCTGG - Intergenic
980858173 4:138465416-138465438 GCTAGAAAACTGAAAAATAGTGG + Intergenic
980953359 4:139403891-139403913 CAGAGAACTCTGAATCATGGCGG + Intronic
982138949 4:152299215-152299237 CAGAGCACACTGAAGAATGCTGG + Intergenic
982536616 4:156615068-156615090 CAGACTAAACTGAAATGTGGTGG + Intergenic
983066606 4:163217417-163217439 AAGAGGAAACTGAAGAAAGGAGG - Intergenic
983100036 4:163614349-163614371 CTGAGGAAACTGAAAAATTGGGG + Intronic
983164347 4:164457200-164457222 AAGAGATAACTGAAAAAAAGGGG + Intergenic
983393777 4:167167920-167167942 TGGAGAAAACTGAATCATGGGGG + Intronic
983570428 4:169202106-169202128 CAGAGATAACTGTAAATTTGGGG - Intronic
983689142 4:170446788-170446810 TAGAGATAATTGAATAATGGAGG - Intergenic
983864811 4:172753108-172753130 TAGAGATAACTGAATCATGGGGG + Intronic
984230068 4:177085192-177085214 CAGACAAAAATGAAAAGGGGAGG + Intergenic
984275384 4:177603453-177603475 CAGAGATAATTGAATCATGGGGG - Intergenic
984405311 4:179321548-179321570 CAGAGAAAAAAGAAAAAGGAAGG - Intergenic
984443718 4:179806334-179806356 CAAATGAAACTGAAAATTGGTGG + Intergenic
985951910 5:3228694-3228716 AATACAAAACTGAAAAAAGGAGG + Intergenic
987252138 5:16110891-16110913 GAGAGAGAACTGAATCATGGGGG + Intronic
987304317 5:16623447-16623469 CAGAGAAAGCTGAAGAAAGCAGG - Intergenic
987512216 5:18855196-18855218 GAGAGAAAATTGAATCATGGGGG + Intergenic
987605641 5:20132364-20132386 TAGAGAAAACTGATAAATATAGG - Intronic
987729244 5:21747047-21747069 CAGAGATAACAGAAAAACGCAGG + Intergenic
987788353 5:22531728-22531750 CGGAAAAGACTCAAAAATGGAGG + Intronic
987830387 5:23087732-23087754 CATAGAATAATGGAAAATGGGGG + Intergenic
987844578 5:23265915-23265937 CAAAGAAAACTGATAAATGGAGG - Intergenic
988541636 5:32115156-32115178 AAGAGATAACTAAAAAAAGGGGG + Intergenic
988993230 5:36691255-36691277 CAGAGAAAAATTCAAAATGGGGG - Intergenic
989198724 5:38742030-38742052 TGGAGATAACTGAATAATGGGGG + Intergenic
989649901 5:43676225-43676247 CTCAGAAAACTGGAAAATTGAGG - Intronic
990111796 5:52335603-52335625 AAGAGAAAATATAAAAATGGTGG + Intergenic
990269308 5:54118245-54118267 CATAGATAACTCAAAAAGGGAGG - Intronic
990397569 5:55399032-55399054 CAGAGAAAACACTAAAATTGCGG - Intronic
990644639 5:57830470-57830492 CATAGAAAAGTGATAAATGATGG + Intergenic
990830187 5:59947555-59947577 AAGAGAAAACTGAAACTTGTAGG + Intronic
990872711 5:60450434-60450456 CACAACAAACTGAAAAATAGGGG + Intronic
992389576 5:76317957-76317979 AAAAGGACACTGAAAAATGGTGG - Intronic
993050943 5:82925136-82925158 CAGAGAAAGCAGGAAACTGGAGG - Intergenic
993927612 5:93889821-93889843 CATAAAAACCTGAAATATGGTGG + Intronic
994038825 5:95233909-95233931 CACAGAAAACTGAAAAACAGTGG + Intronic
994333601 5:98537895-98537917 AAGAGAAGACTGAAAACTGGAGG + Intergenic
994679882 5:102873266-102873288 GAGGGGAAACAGAAAAATGGTGG - Intronic
994870287 5:105339401-105339423 TAGAAAAACCTGAAAAAAGGGGG + Intergenic
995366759 5:111370448-111370470 CAGAAATATCTGAAAAATGGCGG + Intronic
995448202 5:112270240-112270262 CTGAGAAAACTGAAGGATGTAGG + Intronic
995453700 5:112330591-112330613 ATGAGAAAACTGAGGAATGGGGG + Intronic
995508950 5:112888909-112888931 GAGAGATAACTGAATCATGGGGG + Intronic
995818623 5:116201387-116201409 CTGTAAAAACTGAAAAATGCAGG - Intronic
995900038 5:117054863-117054885 CAGAGCAAAATGCAAGATGGGGG - Intergenic
996547903 5:124700101-124700123 CAGAGAACAAAGAAAAATGAAGG - Intronic
997014414 5:129915275-129915297 CTAAGTAAACTGAAAAATTGAGG + Intronic
997184051 5:131863755-131863777 GAGAGATAACTGAATCATGGGGG + Intronic
997342990 5:133160462-133160484 CAGGGAAATATGAAAAATTGAGG + Intergenic
997389379 5:133501475-133501497 CAGACAATACTCAAAACTGGAGG + Intronic
997547134 5:134718106-134718128 CACTGAAAGCTGAAGAATGGGGG - Exonic
997953720 5:138262244-138262266 AAGAGAAAACTGAAAGAGGAAGG + Intronic
998758887 5:145410666-145410688 TAGAGATAACTGAATCATGGGGG - Intergenic
999758004 5:154679663-154679685 CAGAGAAGACAGACAGATGGTGG - Intergenic
1000139281 5:158385821-158385843 TAGAGATAACTGAATCATGGGGG - Intergenic
1000270496 5:159679101-159679123 TAGAGATAATTGAATAATGGAGG + Intergenic
1000466131 5:161579561-161579583 GGGAGATAACTGAATAATGGAGG - Intronic
1000516352 5:162240301-162240323 CAGGGAAAGCTGAATAATAGGGG - Intergenic
1000636191 5:163646284-163646306 CAGGGAAATCTGAAAAATCCAGG - Intergenic
1000745204 5:165024421-165024443 CTGATAAAACTGAATAATGGTGG - Intergenic
1001919138 5:175586933-175586955 GAGAGGAAACTGTAATATGGAGG + Intergenic
1002518382 5:179775707-179775729 CAGAGAAAACTGCAGAAGGTGGG - Exonic
1003642225 6:7885670-7885692 TGGAGAAAACATAAAAATGGAGG - Intronic
1003790704 6:9544201-9544223 CAGAGGAAACAGAAATAGGGTGG + Intergenic
1004049139 6:12057551-12057573 AACAGAAAACAGAACAATGGAGG - Intronic
1004098920 6:12588090-12588112 CAGAGAAGACTGAACATTGTAGG - Intergenic
1004522324 6:16373597-16373619 GGGAGACAACTGAATAATGGGGG + Intronic
1004943333 6:20584953-20584975 CAGAGAAAGCAGAAAACTGCAGG - Intronic
1005088912 6:22035645-22035667 CAGAGCAAAGCTAAAAATGGTGG + Intergenic
1005436845 6:25821228-25821250 GAGAGAAAAAAGAAGAATGGAGG - Intronic
1005631597 6:27713276-27713298 CAGAGAAAAGTGAAGACGGGTGG + Intergenic
1006251941 6:32795011-32795033 TAGAGAAAAGTGAAAGATCGAGG - Intergenic
1007058999 6:38919439-38919461 CAGTGCAAAATGAAAAATGTGGG - Intronic
1007163827 6:39813966-39813988 GAGAGGAAACTGAGAACTGGGGG + Intronic
1007436646 6:41817610-41817632 AAAAGAAAAAAGAAAAATGGTGG - Intronic
1008265886 6:49425790-49425812 CAGAGAAAAAAGTAGAATGGTGG - Intergenic
1008383079 6:50855695-50855717 TAGAGAAAACTGAATCATGGGGG + Intergenic
1008697847 6:54062304-54062326 CAGGGAAAAGTGAAAATTGAGGG - Intronic
1009286918 6:61830161-61830183 CAGACAATACTGGAAAGTGGAGG + Intronic
1009482942 6:64183020-64183042 TAGAGATAACTGAATCATGGGGG + Intronic
1009553992 6:65138538-65138560 AACAGAAAACTGAAAGTTGGAGG + Intronic
1009889109 6:69658589-69658611 AATAGAAAACTGAAAAAAGCAGG + Intergenic
1010773639 6:79861086-79861108 CAGAGGAATCTGGAAAATCGAGG - Intergenic
1011061627 6:83276069-83276091 CAGATTAAACTAAAAAATGTTGG - Intronic
1012867488 6:104635319-104635341 CAGCGCAAACTGTAACATGGAGG + Intergenic
1012926199 6:105270518-105270540 TACAGAAAGTTGAAAAATGGAGG + Intergenic
1012931957 6:105326785-105326807 CAGAGAAAAGAGAAAAATGGAGG + Intronic
1013066331 6:106687593-106687615 TAGAGAAAACAGAAATATTGGGG - Intergenic
1013169190 6:107620769-107620791 CACAGAAAAAAGAAATATGGTGG - Intronic
1013209379 6:107973145-107973167 GAGAGAAAAGAGAAAAAGGGGGG + Intergenic
1013570839 6:111423865-111423887 CAAAGAAAACTGTAAAAGAGGGG + Intronic
1013958776 6:115872497-115872519 CACATAAACATGAAAAATGGAGG - Intergenic
1014670874 6:124302058-124302080 CAGAGATAACTGAATCATGGGGG + Intronic
1015155522 6:130090955-130090977 TACAGAAAGATGAAAAATGGAGG - Intronic
1015195607 6:130521970-130521992 GAGAGAAAATTGAATCATGGGGG - Intergenic
1015299878 6:131641370-131641392 GAGAGAATACTGAGAAAGGGTGG + Intronic
1015506938 6:133998491-133998513 CAAAAATAACTGAAAAATTGAGG - Intronic
1015955572 6:138594757-138594779 CAGAGAAATCTGTAAACTTGGGG - Intronic
1016139597 6:140592941-140592963 TGGAGAAAACTGAATCATGGCGG + Intergenic
1017085653 6:150710539-150710561 CAGAGAAGACTGATACATGCAGG + Intronic
1018573608 6:165235576-165235598 GAGAGATAACTGAATCATGGGGG + Intergenic
1019219994 6:170465477-170465499 CAGATAAATCTCTAAAATGGTGG + Intergenic
1020431353 7:8119364-8119386 CAGAGAACACTGGAAAAAAGAGG + Intronic
1020513303 7:9086805-9086827 CAGAAAAAAATTAAAAATTGTGG + Intergenic
1021323352 7:19239025-19239047 AAGAGATAACTGAATCATGGGGG - Intergenic
1021470981 7:21002375-21002397 CAGAGGAAGCTTCAAAATGGCGG + Intergenic
1021518232 7:21510075-21510097 GGGAGATAACTGAATAATGGGGG - Intronic
1021697433 7:23288205-23288227 CTGAGAAAACTCAAAGCTGGGGG + Intergenic
1021779510 7:24088961-24088983 CAAACAAAAATGTAAAATGGAGG - Intergenic
1021972939 7:25983320-25983342 GAGAGAAAACAGAAAAAGTGTGG + Intergenic
1022230927 7:28410976-28410998 CAGGGAAAGCTGTAAAAAGGCGG - Intronic
1022319257 7:29273091-29273113 GAGAGAAAACGGAAAGATGTAGG - Intronic
1022626027 7:32037079-32037101 CTGAGAAAATTTAAAAAGGGGGG + Intronic
1023172687 7:37404914-37404936 CAGAAAAAAATTAAAAATGGGGG - Intronic
1023519595 7:41037209-41037231 CAGAAAAAACTAAAAAATAATGG - Intergenic
1023645702 7:42312339-42312361 CAGAGAGAACTTCAAAGTGGTGG - Intergenic
1024312587 7:47982919-47982941 ATGAGAAAACTGTAAAATGAAGG + Intergenic
1024374984 7:48626919-48626941 GAGAGAAAACTTAAAGTTGGGGG + Intronic
1024387758 7:48773029-48773051 CAGAGAAGACTGAAATCTTGTGG + Intergenic
1024566813 7:50688219-50688241 CTGGGAAAACTGAAAGATGTTGG - Intronic
1024771845 7:52732374-52732396 CACAGAAATTTTAAAAATGGAGG + Intergenic
1024862120 7:53856913-53856935 CAGAGAAAACTTAGAAAAGCAGG + Intergenic
1025286487 7:57666611-57666633 CTGTGAAAAAAGAAAAATGGTGG - Intergenic
1025628877 7:63249643-63249665 CACAGTAAAATGTAAAATGGTGG + Intergenic
1025653386 7:63494451-63494473 CACAGTAAAATGTAAAATGGTGG - Intergenic
1027485285 7:78754026-78754048 CAGAGAAAACTGATATCTGATGG + Intronic
1028317070 7:89416418-89416440 TAGAGAAAGCAGAAAAGTGGTGG - Intergenic
1028783732 7:94768281-94768303 CAGACAAAACTAATAGATGGTGG - Intergenic
1028938088 7:96488178-96488200 AAGAAAAATCTGAAAAATGAGGG + Intronic
1029400599 7:100343034-100343056 CTGGGAAAACTGAAAAACAGGGG - Intronic
1029555521 7:101266315-101266337 CAGAGATAAGTGAGAAAGGGGGG - Intergenic
1029611403 7:101628462-101628484 AAAAGAAAACAGAAAACTGGAGG + Intronic
1029953449 7:104611721-104611743 CAGAAAATACTAAAAAAGGGGGG + Intronic
1030306736 7:108026538-108026560 CACAGAAAAGTAAGAAATGGTGG + Intronic
1030433525 7:109484476-109484498 CAGAAAAAATTGAAAAATAATGG + Intergenic
1030988959 7:116276989-116277011 AACAGAAAACAGAAAAAAGGAGG - Intergenic
1031061782 7:117060058-117060080 CAGACAAATCCTAAAAATGGTGG - Intronic
1031184585 7:118460407-118460429 CAGAGGAAAATAAAAATTGGAGG + Intergenic
1031393318 7:121242658-121242680 CAAAGAAAAGGAAAAAATGGTGG + Intronic
1032918030 7:136512993-136513015 CAAAGAAAAATGAAAAATTGGGG - Intergenic
1033031684 7:137833094-137833116 CAGAGAAGACAGGAAAATGTGGG - Intronic
1033633585 7:143186419-143186441 CATAGAAAAATGAAACTTGGAGG - Intergenic
1033882876 7:145908314-145908336 CAGAAAAAAAAAAAAAATGGTGG + Intergenic
1034366488 7:150553466-150553488 AATAGAAAACAGAAAAAAGGAGG + Intergenic
1034384503 7:150728063-150728085 CAGAGATAACTGAAATCTGAGGG + Intronic
1035517462 8:248347-248369 AAGAGAACAATGAAAAATGAGGG - Intergenic
1036549267 8:9802488-9802510 CTGGGAAAAATGGAAAATGGTGG + Intergenic
1036584823 8:10113631-10113653 CAGAGCAGACTGAGAAATGTGGG + Intronic
1037423880 8:18733351-18733373 AAAAGGAAACTGATAAATGGAGG + Intronic
1037996665 8:23357364-23357386 CAGAAAAGACTGAAAAAGGCCGG - Intronic
1038144799 8:24885520-24885542 CATAGAAAATGGAAGAATGGGGG - Intergenic
1038306945 8:26413496-26413518 CAGAGGAAACTGAAAAATGTAGG + Intronic
1038348526 8:26755190-26755212 CAGAGAAAAAAAAAAAAAGGAGG - Intronic
1038592336 8:28851385-28851407 CAGAAAAAAGTGAGAATTGGGGG + Intronic
1038800307 8:30743589-30743611 CAGGCAAAACTGAAAAGGGGCGG + Intronic
1039350265 8:36756538-36756560 CAGAGATAACTGAATCATGGAGG + Intergenic
1039705893 8:40007095-40007117 CAGTGAAAAATGAAAGGTGGAGG + Intronic
1039946121 8:42130054-42130076 AAGAGACAACCCAAAAATGGGGG - Intergenic
1040335439 8:46413620-46413642 AAGAGAAAACTGCCAAAGGGTGG + Intergenic
1040475863 8:47776952-47776974 CAGAAAATGCTGAAAAAAGGAGG - Exonic
1040486332 8:47875419-47875441 AATAGGAAACAGAAAAATGGTGG - Intronic
1040956135 8:52981983-52982005 CTGAGCAAAGAGAAAAATGGAGG - Intergenic
1042615702 8:70646603-70646625 CAACAAAAACTGAAAATTGGAGG - Intronic
1043080728 8:75761529-75761551 GAGAGAAAACTGAATCATGGAGG + Intergenic
1043694618 8:83203441-83203463 CGGAGATAACTGAATCATGGGGG + Intergenic
1043960052 8:86407251-86407273 CAGATAAAACCGAAAAAAGAAGG - Intronic
1044019823 8:87092075-87092097 CAAAGAAAATTTAAATATGGAGG + Intronic
1044337214 8:91001230-91001252 CTGAGAAATCTGAATATTGGTGG - Intronic
1044846995 8:96391813-96391835 CAGAGAACACTGAGAGATGCTGG + Intergenic
1044858880 8:96502288-96502310 TGGAGATAACTGAAACATGGGGG - Intronic
1045888669 8:107128539-107128561 TAGAGAAAATTGAATCATGGGGG - Intergenic
1046466159 8:114605908-114605930 GAGAGGAAACTTAAAAAAGGAGG - Intergenic
1046480227 8:114807560-114807582 AAAATAAAACTGAAAGATGGAGG - Intergenic
1048161647 8:132026993-132027015 AAGGGAAAAGGGAAAAATGGTGG - Intronic
1048236224 8:132693256-132693278 AAAAGACAACGGAAAAATGGAGG + Intronic
1048784123 8:138032606-138032628 TAGAGGAAACTGAATCATGGGGG - Intergenic
1048961271 8:139580560-139580582 CAGAGAACATTGAGAAATTGTGG - Intergenic
1049458411 8:142707412-142707434 CAAAGAAAATTGAAAATTTGAGG + Intergenic
1050052626 9:1619040-1619062 CAGTGAAAACTGAAAAACAGTGG + Intergenic
1050275682 9:3996316-3996338 CAGAGAAAACAGAAAAATATGGG + Intronic
1050363148 9:4850352-4850374 CTGTGATAACTGAAGAATGGTGG + Intronic
1050488717 9:6164337-6164359 CAGAGAAATCTAGACAATGGTGG + Intergenic
1050809425 9:9725206-9725228 AAGAGATAACTGAATCATGGGGG + Intronic
1050858274 9:10390453-10390475 CAGAGAAAACTGTTAAAAGGAGG + Intronic
1050897631 9:10902905-10902927 TGGAGATAACTGAATAATGGGGG - Intergenic
1051394848 9:16608767-16608789 CAGTGAGATCTGAAAAATAGAGG + Intronic
1051810174 9:21039641-21039663 CATAGAAGACAGAAAAGTGGGGG + Intergenic
1052078751 9:24177348-24177370 AAGCAAAAACTGACAAATGGGGG - Intergenic
1053245864 9:36534182-36534204 AGAAGAAAACTGAAAAATGTGGG + Intergenic
1053330345 9:37200240-37200262 CAGTGAAGAGTGAAAAAAGGAGG - Intronic
1053381838 9:37655290-37655312 CAGAGAGAATGGAAAGATGGGGG - Intronic
1053579065 9:39384431-39384453 AAGAGAAAATTGAAAAAGGAAGG + Intergenic
1053843580 9:42212516-42212538 AAGAGAAAATTGAAAAAGGAAGG + Intergenic
1054100648 9:60943236-60943258 AAGAGAAAATTGAAAAAGGAAGG + Intergenic
1054585699 9:66963649-66963671 AAGAGAAAATTGAAAAAGGAAGG - Intergenic
1055268772 9:74531380-74531402 CATAGAAAACTGAAAACTTTGGG - Intronic
1055356085 9:75438391-75438413 CACAGAAATCTGAGAGATGGAGG + Intergenic
1055505171 9:76940558-76940580 CTGGAACAACTGAAAAATGGTGG - Intergenic
1055605404 9:77965112-77965134 CAGAGTAAAGTAAAAAAGGGTGG - Intronic
1055639502 9:78308570-78308592 CAGAGTTACCTGAAACATGGAGG - Exonic
1056086954 9:83160222-83160244 CTCAGAAGACAGAAAAATGGGGG + Intergenic
1058601991 9:106680254-106680276 AAGAGAAAATTGAAAAATTCAGG + Intergenic
1059348408 9:113647819-113647841 CAGAGAAAGGAGAAAAATTGGGG + Intergenic
1059773960 9:117456036-117456058 CAGGGAAGAGTGAAGAATGGTGG - Intergenic
1059841298 9:118220577-118220599 TAGAAAAAACTGAAAACGGGAGG - Intergenic
1060613584 9:124990711-124990733 AAAAGAAAAAAGAAAAATGGTGG + Intronic
1060762538 9:126267973-126267995 AAGATAAAACTGAATAAAGGGGG - Intergenic
1061516722 9:131094409-131094431 CACAGAAAACTGTAAAATCAAGG + Intronic
1185780368 X:2838981-2839003 AAGAGAAAACTGAAAAGTTATGG - Intronic
1186147766 X:6642761-6642783 CACAGAAAAATGACAAGTGGGGG - Intergenic
1186335056 X:8577491-8577513 CAGAGATAACTGAAATAGGAAGG + Intronic
1186405716 X:9300584-9300606 AAAAGAAAACTGAAAAACAGAGG - Intergenic
1186822235 X:13301987-13302009 CAGAGAAGGCAGGAAAATGGGGG - Intergenic
1187171763 X:16858985-16859007 TAGAGAAAACCCAAAAATGTGGG + Intronic
1188220047 X:27530360-27530382 TATAGAAAACAGAAGAATGGCGG - Intergenic
1188843102 X:35039608-35039630 AACAGAAAACAGAAAAAAGGAGG + Intergenic
1189136969 X:38560845-38560867 AAGACAAATCTGAAAAATGGAGG + Intronic
1189674462 X:43446845-43446867 GAGAGATAACTGAATCATGGAGG + Intergenic
1190917049 X:54818599-54818621 AAGAAAAAACTGAAAATTGTGGG - Intergenic
1191644344 X:63464130-63464152 AAGAGAAAACAGAAAAATGCAGG - Intergenic
1191682865 X:63859163-63859185 TAGAGAAAACTGAGAAGTAGTGG - Intergenic
1192782658 X:74309689-74309711 AAAAGAAAACTGAAAGGTGGTGG + Intergenic
1192980029 X:76329590-76329612 CAGAGACAACTTAAGATTGGAGG + Intergenic
1193021881 X:76800512-76800534 CACAGAAAACTGAGACATGGGGG + Intergenic
1193041740 X:77011187-77011209 AAGAGAGAACTGTAAAAGGGAGG - Intergenic
1193199107 X:78666572-78666594 CAGAGATAATTGAATCATGGGGG + Intergenic
1193322701 X:80141895-80141917 CAGAAGAAAATGTAAAATGGAGG - Intergenic
1193388542 X:80899502-80899524 GAAAGAAAACAGAAAAATGGAGG - Intergenic
1193441581 X:81546014-81546036 TAGAGAAAAGTGATGAATGGAGG - Intergenic
1193585327 X:83314297-83314319 CTTATAAAACTGAAAAATAGAGG + Intergenic
1193792582 X:85833537-85833559 CAGAGATAATTGAATCATGGGGG + Intergenic
1193813300 X:86076983-86077005 CAGAGATCACTAAAAAATGTGGG + Intergenic
1194031815 X:88826181-88826203 CAGAGAAAAGTGAAAAGTGGGGG - Intergenic
1194257056 X:91646968-91646990 GAGAGATAACTGAATCATGGGGG + Intergenic
1194662756 X:96644766-96644788 CAGTGATATTTGAAAAATGGAGG - Intergenic
1195250720 X:103043549-103043571 CAGAGAAGACAGAAAAAGAGTGG - Intergenic
1195749610 X:108150753-108150775 TAGAGATAACTGAATCATGGGGG - Intronic
1195907026 X:109854188-109854210 GAGAGACAACAGAAAAATAGAGG + Intergenic
1195963540 X:110409618-110409640 CAGCAACAACAGAAAAATGGGGG - Intronic
1196226405 X:113172566-113172588 CAGATAAAACAAAAAGATGGAGG + Intergenic
1196263370 X:113612451-113612473 CAGAGAACATTGAAAAAGAGTGG - Intergenic
1196547125 X:116975393-116975415 AAGAGAAAATTGAATCATGGGGG + Intergenic
1196633370 X:117969857-117969879 TAAAGAAAACTTAAAAATGTTGG + Intronic
1196891453 X:120294521-120294543 AAGGGAAAACTGGCAAATGGTGG - Intronic
1197169703 X:123418223-123418245 GAGAGCAAAATGAAAAAGGGAGG - Intronic
1197224317 X:123941277-123941299 CAGAGAAAAAGGAATAAAGGTGG + Intergenic
1197314053 X:124942016-124942038 GAGAGAAAATTGAATCATGGGGG - Intronic
1197450642 X:126611088-126611110 TACAGACAACTGAAAAATCGTGG + Intergenic
1197561328 X:128025419-128025441 CAAAGAAGACAGAAAAATGTGGG - Intergenic
1197644737 X:129005140-129005162 CTGAGTAAGCTAAAAAATGGTGG - Intergenic
1197908807 X:131457676-131457698 CAGAGAAGACTGAAAAACAGTGG + Intergenic
1197971201 X:132116868-132116890 CTGAGATAACTGCAACATGGTGG + Intronic
1198299799 X:135324125-135324147 CAGTAAAAGATGAAAAATGGAGG + Intronic
1198996584 X:142579762-142579784 GAGAGATAATTGAATAATGGGGG + Intergenic
1199055331 X:143287301-143287323 CAGTGAAAAGTGAAAATTTGGGG + Intergenic
1199313915 X:146354606-146354628 AAGAGAACACTGAAAATTGGAGG + Intergenic
1199571495 X:149271399-149271421 GGGAGAAAATTGAATAATGGGGG - Intergenic
1199735860 X:150686137-150686159 CAGGGCAAAATGAAAAATGCAGG - Intergenic
1200052392 X:153441582-153441604 CAGATTAAACTGAAGAATGCTGG + Intergenic
1200575766 Y:4886234-4886256 GAGAGAGAACTGAATCATGGGGG + Intergenic
1202036607 Y:20643170-20643192 AAGTGAAAATTGAAAAATAGCGG + Intergenic
1202125901 Y:21568760-21568782 CACAGGAAAATGAAACATGGCGG - Intergenic
1202153102 Y:21860631-21860653 CACAGGAAAATGAAACATGGCGG + Intergenic
1202301153 Y:23415892-23415914 CTGAGCAAGCTGAAGAATGGAGG + Intergenic
1202350371 Y:23983586-23983608 AAAGCAAAACTGAAAAATGGGGG - Intergenic
1202520408 Y:25686535-25686557 AAAGCAAAACTGAAAAATGGGGG + Intergenic
1202569658 Y:26254706-26254728 CTGAGCAAGCTGAAGAATGGAGG - Intergenic