ID: 901598213

View in Genome Browser
Species Human (GRCh38)
Location 1:10401684-10401706
Sequence TGTTAACTGGAGCCTTGTAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 105}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901598213 Original CRISPR TGTTAACTGGAGCCTTGTAG GGG Intronic
901032945 1:6318897-6318919 GGTTAACTAGAGCCTGGTGGAGG - Intronic
901598213 1:10401684-10401706 TGTTAACTGGAGCCTTGTAGGGG + Intronic
908501565 1:64748088-64748110 TTTTAACTGGAAGCTTTTAGAGG + Intronic
915898506 1:159829509-159829531 TGTTAAGCTGAGCCTTGAAGAGG - Intronic
922474558 1:225898338-225898360 TGTTAACGAGAGCACTGTAGGGG + Intronic
923766573 1:236897779-236897801 TATTTAGTGGAACCTTGTAGAGG + Exonic
1067371121 10:45683297-45683319 TGTTAACATGAGACTTGGAGGGG + Intergenic
1067388661 10:45842855-45842877 TGTTAACATGAGACTTGGAGGGG - Intronic
1067417403 10:46114102-46114124 TGTTAACATGAGACTTGGAGGGG + Intergenic
1067445602 10:46341717-46341739 TGTTAACATGAGACTTGGAGGGG + Intergenic
1067502818 10:46820985-46821007 TGTTAACATGAGACTTGGAGGGG + Intergenic
1067591772 10:47519026-47519048 TGTTAACATGAGACTTGGAGGGG - Intronic
1067638887 10:48027100-48027122 TGTTAACATGAGACTTGGAGGGG - Intergenic
1067874596 10:49993199-49993221 TGTTAACATGAGACTTGGAGGGG + Intronic
1070135876 10:73693256-73693278 TGTTAACATGAGACTTGGAGGGG - Intronic
1070332628 10:75429301-75429323 TCTTAGGTGGAGCCTTGTGGGGG + Intergenic
1071086166 10:81871176-81871198 TGTTTACTGGAATCATGTAGAGG - Intergenic
1074575090 10:114661399-114661421 ATTTAACTGGAGCCATGTGGAGG - Intronic
1077368325 11:2170286-2170308 TGTTCACTGGGGCCCTGTGGGGG - Intronic
1077875834 11:6304472-6304494 TGTTCACTGGTGCCTTTTTGGGG + Intergenic
1079688865 11:23397605-23397627 CGTTAACTGGAACTTTGTACTGG - Intergenic
1080623094 11:34003978-34004000 TGTTAACTGGTCCAGTGTAGTGG + Intergenic
1084602246 11:70152771-70152793 TGTTCACTGCAGCCTGGTACAGG + Intronic
1091163030 11:133443600-133443622 TGTTAACTGCAGCAATGAAGGGG - Intronic
1091891547 12:4058925-4058947 TGTTCACTGGAACCTTGCAGTGG - Intergenic
1093937285 12:25014785-25014807 TGGTAAGTGGAGACTTGTGGAGG - Intergenic
1116082984 14:40200100-40200122 TGTTAACTGGAGACTTGGGTGGG + Intergenic
1116424174 14:44769292-44769314 TGGTTACTGGAGCTTTGCAGGGG + Intergenic
1120414828 14:84206317-84206339 TGTTAACTCGAGCCTTGGGAGGG + Intergenic
1125360747 15:38862184-38862206 TCTTAGCTGGAGCCTTGCAATGG - Intergenic
1126502630 15:49363014-49363036 TGGTTACTGTAGCCTTGTAGTGG + Intronic
1130716373 15:86338891-86338913 TGTTAACTGTAGGTTTGTTGTGG + Intronic
1130867410 15:87944627-87944649 TGTGAACTGGATCATTTTAGTGG - Intronic
1133435476 16:5775653-5775675 TGTTTCCTGGAGCCCTGAAGTGG - Intergenic
1134086360 16:11360084-11360106 TGTAAACTGGAGGCTCCTAGAGG + Intronic
1136011377 16:27365518-27365540 TTTAAACTGGAGCTTTGAAGAGG - Intergenic
1137989964 16:53144289-53144311 TTTTAACTGGATGCTTGTAAAGG - Intronic
1140852697 16:78949633-78949655 AGTTAACACGAGCCTTGGAGAGG - Intronic
1143291781 17:5836925-5836947 AGTTAACTTAAGCCTTTTAGAGG - Intronic
1144741009 17:17582205-17582227 TGCAACCTGGAGCCTTGGAGTGG - Intronic
1147645593 17:42031841-42031863 TGTGAACTGGAGCCCAGCAGGGG + Intronic
1153181272 18:2436908-2436930 TGTTAACTTGAGGATTGTAAAGG + Intergenic
1155512585 18:26593123-26593145 TGTTAACCTGAGCCATGTGGTGG - Intronic
1159211277 18:65325589-65325611 TGATAACTGGAGCTTTCTAAGGG + Intergenic
1160026219 18:75218754-75218776 TGTGAACTTGAGCCTTGTCCCGG - Intronic
1167496769 19:49824033-49824055 TGTTAAATGGAGACTTCTTGAGG + Intronic
926134425 2:10326471-10326493 TGTTGGCTGGAGACTTGTGGGGG + Intronic
926851305 2:17200861-17200883 TGTATCCTGGAGCCTAGTAGGGG + Intergenic
932710198 2:74057453-74057475 AGATAACTGGATGCTTGTAGAGG - Intronic
933650033 2:84843087-84843109 TGTTGTCTGGAGCCTCGTAGGGG - Intronic
934481184 2:94646514-94646536 TGGTTACTGTAGCCTTGCAGGGG + Intergenic
935535394 2:104287144-104287166 AGTTAACTTTAGCCATGTAGAGG - Intergenic
935588255 2:104821317-104821339 TGTTGAATGTAGCCTTGGAGCGG - Intergenic
940997696 2:160167876-160167898 TCTAAACTGGAGCCTTGCTGTGG + Intronic
942747645 2:179253359-179253381 TGTTAACTGGAGACTTGCTTTGG - Intronic
942799951 2:179863021-179863043 TGTTGACTGGAGACTTTAAGGGG - Intergenic
945800089 2:214418094-214418116 ATTTAAATGGAGCCTTGAAGTGG - Intronic
945883461 2:215350509-215350531 TGTGAACTGGAACCTTAGAGGGG + Intergenic
1180687513 22:17681059-17681081 TGTCTCCTGGAGCCTTTTAGTGG + Intronic
951204193 3:19909043-19909065 TGTCAACTTGGTCCTTGTAGGGG - Intronic
955568317 3:60273707-60273729 TGTTAATTGCTGCCTTGTAATGG - Intronic
957211492 3:77264597-77264619 TGTCAACTGGATCCTTCTAGAGG + Intronic
959124125 3:102269414-102269436 TGGAAACTGGAGCTTTGTAGGGG + Intronic
959167623 3:102800290-102800312 TGTTAAGAGGAGTCTAGTAGTGG + Intergenic
959348070 3:105224254-105224276 TGTTGACTAGAACCTTATAGTGG - Intergenic
963283480 3:143410247-143410269 TGCTAACTGCAGCCCTGTACTGG + Intronic
963817479 3:149848020-149848042 TGTAAACTGGAGTGTTGTGGTGG + Intronic
966000519 3:174943782-174943804 TGTTGACTGGAGCTTGTTAGAGG + Intronic
966472447 3:180306279-180306301 TGTTAGCTAGAGGCTAGTAGAGG + Intergenic
967824548 3:193868046-193868068 TTTTAAATGGGGCCTTGAAGGGG - Intergenic
976425335 4:84896583-84896605 GGGAAACTGGAGCCCTGTAGTGG - Intronic
977051715 4:92136474-92136496 TACAAACTGGAGCCTTTTAGAGG - Intergenic
977581611 4:98730827-98730849 TTATAACTGGAGGATTGTAGAGG + Intergenic
979270774 4:118758767-118758789 AGTTATCTCTAGCCTTGTAGTGG - Intronic
984064416 4:175030271-175030293 TGTTAAGTGGAGACTTATGGAGG - Intergenic
994967373 5:106691708-106691730 CGTTGAATGGAGCCATGTAGAGG - Intergenic
996148038 5:119999161-119999183 TGTTAACTGCAGCCTTCTGAGGG - Intergenic
999055931 5:148576569-148576591 TGGTTACTGTAGCCCTGTAGTGG - Intronic
1002796269 6:473551-473573 TGTTAACTGAAGCCATGGAGAGG - Intergenic
1004135674 6:12963691-12963713 TCTGAAATGGAGCCTGGTAGAGG - Intronic
1011289954 6:85766474-85766496 TATTAAGTGGAGCCTTTTGGAGG - Intergenic
1011884307 6:92075103-92075125 TGATAACTGCATACTTGTAGGGG + Intergenic
1014591392 6:123276132-123276154 TGACAGCTGGAGCCTTGAAGAGG - Intronic
1016252472 6:142060824-142060846 TGTTGGCTGGAGGCTTGAAGAGG - Intronic
1016427936 6:143954142-143954164 TGTCAGCTGGGGCCTTGTATAGG - Intronic
1018013275 6:159691421-159691443 TGTTGACTGGAGGCATCTAGTGG - Intronic
1020822097 7:12983195-12983217 TTTTTACTGGAGCATTGTAATGG + Intergenic
1027930538 7:84528463-84528485 TGTTAATTGAAGCCTCGTTGAGG + Intergenic
1028457173 7:91051123-91051145 TGTTAAAAAGAGCCTTGTATTGG - Intronic
1031152741 7:118073554-118073576 TCTTAACTGGAGCCTTAGAAGGG + Intergenic
1031184290 7:118456498-118456520 TGTTAACTGGAACTTTGTTTTGG + Intergenic
1037112763 8:15184792-15184814 TTTTACCTGCAGCCTTGTAATGG + Intronic
1043611968 8:82076074-82076096 TGTGAAGTGGAGCCTTGTTTTGG + Intergenic
1047423405 8:124726118-124726140 TTTTAACTGGAACCATGCAGGGG + Intronic
1047557997 8:125954163-125954185 TGGTAACTGTAGCCTTGTATAGG - Intergenic
1050960171 9:11720074-11720096 TGGTTACTGTAGGCTTGTAGTGG + Intergenic
1051940886 9:22504267-22504289 TGGTTACTGTAGCCTTGTAGTGG + Intergenic
1052000210 9:23269595-23269617 TCTTGATTGCAGCCTTGTAGAGG - Intergenic
1052219913 9:26007702-26007724 TGATAAGTGGAGCCTTTAAGAGG + Intergenic
1052470789 9:28893370-28893392 TGTTAATTGCAGCATTGTAATGG - Intergenic
1053676653 9:40437460-40437482 TGGTTACTGTAGCCTTGCAGGGG - Intergenic
1053926419 9:43063553-43063575 TGGTTACTGTAGCCTTGCAGGGG - Intergenic
1054287066 9:63187450-63187472 TGGTTACTGTAGCCTTGCAGGGG + Intergenic
1054289721 9:63272984-63273006 TGGTTACTGTAGCCTTGCAGGGG - Intergenic
1054387752 9:64577524-64577546 TGGTTACTGTAGCCTTGCAGGGG - Intergenic
1054507969 9:65938844-65938866 TGGTTACTGTAGCCTTGCAGGGG + Intergenic
1061345962 9:130025315-130025337 TGTTAACAGGAGGTTTGTAAAGG - Intronic
1192429488 X:71102614-71102636 TGTTATCTGCAGCCTTCTAAGGG - Exonic
1192707007 X:73537258-73537280 TGAAAACTGGAGATTTGTAGTGG - Intergenic
1193273617 X:79558040-79558062 TGTTTACTTGTTCCTTGTAGTGG + Intergenic
1196625472 X:117872233-117872255 TGTTTCCTGCAGACTTGTAGAGG - Intergenic
1197048860 X:122033985-122034007 TGATAACTGTAGCCTTGTAATGG + Intergenic
1198038884 X:132829546-132829568 TGTTAACTGTACCCATGTACAGG + Intronic
1198119999 X:133582961-133582983 TGAGAACTGGATTCTTGTAGTGG + Intronic
1198955891 X:142129873-142129895 TGTTATCTGAAGCCTCGCAGTGG - Intergenic