ID: 901599483

View in Genome Browser
Species Human (GRCh38)
Location 1:10411645-10411667
Sequence GTCCATGCAGGCCACCCGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 73}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901599483_901599485 -7 Left 901599483 1:10411645-10411667 CCATTCGGGTGGCCTGCATGGAC 0: 1
1: 0
2: 1
3: 2
4: 73
Right 901599485 1:10411661-10411683 CATGGACTCAGCCTAATTTGAGG 0: 1
1: 0
2: 0
3: 18
4: 356
901599483_901599488 11 Left 901599483 1:10411645-10411667 CCATTCGGGTGGCCTGCATGGAC 0: 1
1: 0
2: 1
3: 2
4: 73
Right 901599488 1:10411679-10411701 TGAGGGAAACTGTTAGTAATAGG 0: 1
1: 0
2: 0
3: 14
4: 197
901599483_901599486 -6 Left 901599483 1:10411645-10411667 CCATTCGGGTGGCCTGCATGGAC 0: 1
1: 0
2: 1
3: 2
4: 73
Right 901599486 1:10411662-10411684 ATGGACTCAGCCTAATTTGAGGG 0: 1
1: 0
2: 0
3: 13
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901599483 Original CRISPR GTCCATGCAGGCCACCCGAA TGG (reversed) Intronic
900530897 1:3152731-3152753 GTCCATGCAGCCCTCCCCAGGGG - Intronic
901599483 1:10411645-10411667 GTCCATGCAGGCCACCCGAATGG - Intronic
1066620499 10:37344662-37344684 CTCCAGGCAGGCCACCAGCAGGG + Intronic
1066623761 10:37385199-37385221 CTCCAGGCAGGCCACCAGCAGGG + Intergenic
1072256993 10:93630337-93630359 GTTCATCCAGCCCACCAGAAGGG + Intronic
1072349838 10:94545914-94545936 GTCCAGGCATGCCAGCGGAACGG + Exonic
1072481776 10:95815947-95815969 GTGCAGGCAGCCCACCCTAAGGG - Intronic
1072818814 10:98536101-98536123 GTCCATGCAGGACTTCCTAAGGG - Intronic
1072832154 10:98670185-98670207 GGCCATGCAGGCCACTCTAAGGG + Intronic
1073366688 10:102948582-102948604 GACCTTGCAGGCCACACTAAGGG + Intronic
1075269845 10:121039125-121039147 TTCCATTCATGCCACCCTAATGG + Intergenic
1090362333 11:126182253-126182275 GTCCCTCCAGGCCTCCCGAGAGG + Intergenic
1094476321 12:30843421-30843443 GTCTATGGAGAACACCCGAAAGG + Intergenic
1098387455 12:69934322-69934344 GTCCAGGCATGTCACCCCAAGGG + Intronic
1116186384 14:41605754-41605776 ATCCACGGAGGCCACCCGTATGG + Intergenic
1116804149 14:49475328-49475350 CTCCATGCAGGCCATCCTCAAGG + Intergenic
1116962585 14:50981901-50981923 GTCCATGCGAGCCACACCAAAGG + Exonic
1121976929 14:98413567-98413589 GTTCATGCAAGCCACACCAATGG + Intergenic
1122168917 14:99854505-99854527 GTGCAAGCAGGCCAACCGCAGGG - Intronic
1123110449 14:105864679-105864701 GCCCGTGCAGGACACTCGAATGG + Intergenic
1128133477 15:65246066-65246088 GGTCATGCTGGCCACCCCAATGG - Intronic
1134107203 16:11493661-11493683 GGCCATCCAGGCCTTCCGAAGGG - Exonic
1144788568 17:17845193-17845215 GTGCAAGCAGGCCACCTGAGGGG + Intronic
1147969685 17:44212688-44212710 GTCCATGCAGCCCACCCCTGGGG + Intronic
1150790486 17:68197769-68197791 GTCCAACCAGGCCCCCCGTAGGG - Intergenic
1151372087 17:73654354-73654376 GTCCATGCAGACCAACAGCATGG + Intergenic
1161296680 19:3523732-3523754 GTCTATGCAGGCCAGCCCATGGG - Intronic
1164856381 19:31527752-31527774 GTCCATGCAGGTCACCTCCAAGG - Intergenic
927294598 2:21439934-21439956 GTCCATGTAATCCTCCCGAATGG + Intergenic
933705028 2:85283376-85283398 GAAAATGCAGGCCACCCCAATGG + Intronic
933804196 2:85986490-85986512 GTCCCAGCAGGCCACAGGAATGG - Intergenic
936251445 2:110871193-110871215 GTCCAGGCAGGCACACCGAAAGG - Intronic
939102952 2:137916403-137916425 GTCCATCCAGGCCAGCACAAAGG + Intergenic
946167444 2:217873592-217873614 GTCCATGAGGGCCACCTGCAGGG + Intronic
947219845 2:227781618-227781640 GGCCAAGCAGGCGACCTGAAAGG - Intergenic
948756704 2:240163594-240163616 GGCCACGCAGGCCAACCCAAGGG + Intergenic
1172114823 20:32567401-32567423 CTCCATGGAGGCCACCAGGAAGG - Intronic
1174603446 20:51743173-51743195 GTCCATGCATGCAACACGCAGGG - Intronic
1174686899 20:52465003-52465025 GTCACTGCAGGCCACCCTCATGG + Intergenic
1178037781 21:28603927-28603949 GTTCAGGCAGGCCACCTGCATGG - Intergenic
1179625402 21:42646323-42646345 GTCCAGGCAGACCACCCCAGAGG + Intergenic
1180090533 21:45531594-45531616 GTCCCCACAGGCCACCCGCAGGG + Exonic
1180167144 21:46036103-46036125 GTCCATGCAGTGCAGCCCAACGG + Intergenic
1180741380 22:18055423-18055445 GTCACTGCAGGCCACCAGAAAGG - Intergenic
1183714220 22:39524300-39524322 GTCTATGCTGGGCACCAGAAAGG - Intergenic
954774650 3:53005914-53005936 GTCCAAGCCGGCAACCAGAAGGG + Intronic
968798934 4:2729351-2729373 GTGCAGGCAGCCCACCCCAAGGG + Intronic
980913659 4:139015511-139015533 TTCCATGCTGGCCAGCGGAAGGG + Intergenic
981718636 4:147776949-147776971 GTCACTGCAGGCCACCAGGAAGG - Intronic
986339330 5:6775893-6775915 GGCGCTGCAGGCCACCCGCAGGG + Intergenic
991498541 5:67252443-67252465 GTCCAGGCAGGCAACCCGAAAGG + Intergenic
993275039 5:85846597-85846619 GGCCTTGAAGGCCACCTGAAGGG - Intergenic
999240768 5:150126208-150126230 GCCCATGCAGTCCACCTCAAAGG + Intronic
1003086688 6:3065784-3065806 GTCCTTGCAGAACACCAGAATGG - Intronic
1003196418 6:3919124-3919146 GTGCAGGCAGCCCACCCTAAGGG - Intergenic
1003395532 6:5749419-5749441 TTCCATCCAGGCCACCAGCAGGG - Intronic
1007422939 6:41730431-41730453 GGCCATGCAGGCCACCTGGTTGG - Intronic
1008030410 6:46688172-46688194 GTCCACGAAGGACACCCGCAGGG - Exonic
1009622456 6:66094857-66094879 GGAGATGCAGGCCACCCGATAGG + Intergenic
1013184692 6:107747169-107747191 GTCCATGTGGGCCACCATAATGG - Intronic
1019638673 7:2090666-2090688 GCCCAGGCAGGCCCCCCGCAGGG + Intronic
1026893974 7:73999634-73999656 GGCCAGGTCGGCCACCCGAAGGG - Intergenic
1029260506 7:99299490-99299512 GTCCTTGCAGGCCAGCCTAGAGG + Intergenic
1029742202 7:102497084-102497106 AGCTATGCAGGGCACCCGAATGG - Intronic
1032458708 7:132093566-132093588 GTCCTTGCAGCCCAGCCTAAGGG + Intergenic
1033290615 7:140079633-140079655 GTTCCTGCAGTCCACCTGAATGG - Intergenic
1035269653 7:157711916-157711938 GGCCATGCAGGCCACATGAGTGG + Intronic
1053279060 9:36805702-36805724 GTCCATGCAGGCCAAGGGAGAGG + Intergenic
1058481855 9:105403883-105403905 GGTCTTGCAGGCCACCCTAACGG + Intronic
1059440613 9:114304753-114304775 CTCCATGCAGGCCACATGGAAGG - Intronic
1060839806 9:126784512-126784534 TTCCCTGCAGGCCTCCCGGAAGG + Intergenic
1062122009 9:134838899-134838921 GTCCCTGCATGCCACCCCCATGG - Intronic
1191103636 X:56759123-56759145 GCACATGCAGGTCACCAGAATGG - Intergenic
1202274194 Y:23098697-23098719 GTGCTGGCAGGCCACCCCAAGGG + Intergenic
1202291832 Y:23321980-23322002 GTGCTGGCAGGCCACCCCAAGGG - Intergenic
1202427190 Y:24732442-24732464 GTGCTGGCAGGCCACCCCAAGGG + Intergenic
1202443601 Y:24937652-24937674 GTGCTGGCAGGCCACCCCAAGGG - Intergenic