ID: 901600763

View in Genome Browser
Species Human (GRCh38)
Location 1:10421801-10421823
Sequence GCACCCAGCCTTGCTGCCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 234}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901600763_901600769 18 Left 901600763 1:10421801-10421823 CCAGTGGCAGCAAGGCTGGGTGC 0: 1
1: 0
2: 1
3: 16
4: 234
Right 901600769 1:10421842-10421864 CCCAGCACTTTGGAAGGCCGAGG 0: 3200
1: 124416
2: 267449
3: 211586
4: 127680
901600763_901600773 25 Left 901600763 1:10421801-10421823 CCAGTGGCAGCAAGGCTGGGTGC 0: 1
1: 0
2: 1
3: 16
4: 234
Right 901600773 1:10421849-10421871 CTTTGGAAGGCCGAGGTGGGAGG 0: 838
1: 30984
2: 116866
3: 161967
4: 169635
901600763_901600765 8 Left 901600763 1:10421801-10421823 CCAGTGGCAGCAAGGCTGGGTGC 0: 1
1: 0
2: 1
3: 16
4: 234
Right 901600765 1:10421832-10421854 ACACCGTAAGCCCAGCACTTTGG 0: 1
1: 31
2: 415
3: 1800
4: 21440
901600763_901600771 21 Left 901600763 1:10421801-10421823 CCAGTGGCAGCAAGGCTGGGTGC 0: 1
1: 0
2: 1
3: 16
4: 234
Right 901600771 1:10421845-10421867 AGCACTTTGGAAGGCCGAGGTGG 0: 2367
1: 94982
2: 187541
3: 136019
4: 71894
901600763_901600772 22 Left 901600763 1:10421801-10421823 CCAGTGGCAGCAAGGCTGGGTGC 0: 1
1: 0
2: 1
3: 16
4: 234
Right 901600772 1:10421846-10421868 GCACTTTGGAAGGCCGAGGTGGG 0: 1141
1: 42359
2: 191526
3: 269613
4: 181395
901600763_901600767 12 Left 901600763 1:10421801-10421823 CCAGTGGCAGCAAGGCTGGGTGC 0: 1
1: 0
2: 1
3: 16
4: 234
Right 901600767 1:10421836-10421858 CGTAAGCCCAGCACTTTGGAAGG 0: 3
1: 142
2: 13723
3: 316391
4: 266685

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901600763 Original CRISPR GCACCCAGCCTTGCTGCCAC TGG (reversed) Intergenic
901600763 1:10421801-10421823 GCACCCAGCCTTGCTGCCACTGG - Intergenic
902320893 1:15664972-15664994 CCACCGAGCCTAGCTGCAACTGG - Exonic
902755620 1:18547502-18547524 GCTCACAGGCCTGCTGCCACAGG + Intergenic
903968875 1:27106325-27106347 GCCCCCAGCCCTCCAGCCACTGG - Intronic
904160383 1:28518452-28518474 GCACCGCGCCTTCCTGCCTCCGG - Intronic
904567982 1:31439441-31439463 GCCCACTGACTTGCTGCCACAGG + Intergenic
911766455 1:101681423-101681445 GCACCCTGCCTGACTGCCACTGG + Intergenic
912123684 1:106506331-106506353 GGGCAGAGCCTTGCTGCCACTGG + Intergenic
913564767 1:120062072-120062094 ACACCCAGAGTTGCTGCCTCAGG - Intronic
913633364 1:120731491-120731513 ACACCCAGAGTTGCTGCCTCAGG + Intergenic
914285354 1:146221422-146221444 ACACCCAGAGTTGCTGCCTCAGG - Intronic
914546385 1:148672177-148672199 ACACCCAGAGTTGCTGCCTCAGG - Intronic
914620180 1:149398493-149398515 ACACCCAGAGTTGCTGCCTCAGG + Intergenic
915311319 1:155007247-155007269 ACACCCTGCCCTGCTGCCCCTGG + Intronic
915487830 1:156234341-156234363 CCACCCACCCTTTCTCCCACAGG - Intronic
916559287 1:165919130-165919152 GCCCCAAGCCTGGCTGACACAGG - Intergenic
917790696 1:178496927-178496949 GTGCCCAGCCATGCTGCCCCGGG - Intergenic
917964201 1:180168207-180168229 GCACGCAGCCTGGATGCCTCAGG + Intronic
918048706 1:180956261-180956283 GCAGGCAGCCTGGCAGCCACAGG - Intergenic
918736246 1:188066995-188067017 GCACCCTGCCATGCTATCACTGG - Intergenic
919156320 1:193770409-193770431 GCTCCCAGCTGTGCTGTCACTGG - Intergenic
920883163 1:209899063-209899085 CCAGCCAGCCTTGCTGGCCCCGG - Intergenic
921929483 1:220743394-220743416 TCAGCAAGCCTTGCTTCCACAGG - Intergenic
922974399 1:229771496-229771518 GCCCACAGCCTTGCCCCCACTGG - Intergenic
923480383 1:234377958-234377980 GTAACCAGTCTTGCTGCCAGGGG + Intronic
1063566594 10:7176828-7176850 ACCCCCAGCCTTGCAGACACTGG + Intronic
1064416325 10:15153404-15153426 GCTCCCATCCTTGCCACCACTGG + Intronic
1064918051 10:20484393-20484415 TGACCCTGTCTTGCTGCCACTGG + Intergenic
1065558762 10:26941694-26941716 GCTCTCAGGCTTGCTGCCTCCGG - Intergenic
1067801787 10:49364004-49364026 CCACCCAGCCCTGCAGCCTCAGG + Intergenic
1069587626 10:69618961-69618983 GCAGTCAGCCTTGGTGTCACAGG + Intergenic
1069992691 10:72324987-72325009 GCACCCAGCCCTGCATCCACAGG - Intergenic
1071776100 10:88789698-88789720 GCAACCAGCTTCGCTGCCTCAGG - Intergenic
1072813359 10:98481075-98481097 GCACACAGTCTTCCTGACACTGG + Intronic
1073123024 10:101133444-101133466 GCACCAGGCCCTGCTGCCCCAGG - Intronic
1074529040 10:114284561-114284583 GCACCCACACTTGATGCTACGGG + Intronic
1075266333 10:121002191-121002213 GCACCAATCGTTGCTGCCAGGGG + Intergenic
1076046413 10:127297531-127297553 GCACCCTTCCTTGGTGTCACTGG - Intronic
1076722495 10:132398849-132398871 GCAGCCAACCTTGCTGCCTTGGG + Intronic
1078151945 11:8766911-8766933 ACACACAGCCTTGCTGCCAGAGG - Intronic
1078355378 11:10628495-10628517 CCACCCAGCCTTCCTGACCCTGG + Intronic
1081872899 11:46391425-46391447 GCCCCCGGCCTTGCTTCCAGCGG + Intergenic
1082278768 11:50247493-50247515 GCTCCCCACCTTTCTGCCACCGG - Intergenic
1082797544 11:57388933-57388955 GCCCCCAGCATTGCTATCACTGG - Intronic
1084005024 11:66317960-66317982 GCACCCTGCCTTCCTGACGCAGG - Intergenic
1084025331 11:66444818-66444840 AGACCCAGCCTTGCTTCCTCTGG - Intronic
1084396840 11:68916689-68916711 GCAAGCAGCCTCGATGCCACGGG - Intronic
1085251621 11:75147781-75147803 GCATCCATCCTTGCTGCCCTTGG + Intronic
1085252060 11:75150587-75150609 CCACCCAGGCAGGCTGCCACTGG + Intronic
1085457176 11:76671716-76671738 GTACCCTGCCTTGCTGCCTGTGG + Intergenic
1086942533 11:92813347-92813369 TCACCCAGCCCTTCTCCCACTGG + Intronic
1089369660 11:117946456-117946478 CCACCCAGCCGTGCTTCCCCAGG - Intergenic
1089782653 11:120884466-120884488 GCACCCCGCCTGGCTGGCATGGG - Intronic
1089834041 11:121354247-121354269 GCAACCATCCTTCCTGCCATTGG + Intergenic
1090404291 11:126467773-126467795 GCATCCAGCCTTGAGGCCAGAGG + Intronic
1091589112 12:1832931-1832953 GCACCCAGCTTTGCATCCCCAGG + Intronic
1093403474 12:18776775-18776797 TCAGCAAGCCTTGCTGCCATGGG + Intergenic
1094572089 12:31650041-31650063 GCACTCAGCCCTGCTGTCAGAGG + Intronic
1096634184 12:52948340-52948362 GCTCCCAGCCTTTCTTCCCCGGG + Intronic
1097919144 12:65052855-65052877 GCACCCAGCCATTCTTCCAAAGG - Intronic
1098363851 12:69681791-69681813 CCACCACGCCTTGCTGCCATTGG - Intronic
1103403261 12:120657735-120657757 GCACCTGGCTTTGCTGCCCCCGG + Intronic
1103939255 12:124493010-124493032 GGGCCCAGCCTGGCGGCCACAGG - Intronic
1106513439 13:30431638-30431660 GCACACAGCCTTCCTGGCTCAGG + Intergenic
1108577413 13:51802259-51802281 ACACCCAGCCTCGGTGCCAAAGG + Intronic
1108728582 13:53208011-53208033 TCACCCAGCCTTGCTGCCCCTGG - Intergenic
1108999458 13:56779545-56779567 GCACTCAGCCTTGCAGAAACTGG + Intergenic
1109430671 13:62229947-62229969 GCACCCAGCCTTGCCGAGGCTGG + Intergenic
1113676261 13:112209783-112209805 GCACCCTGCCTGCCTTCCACAGG - Intergenic
1113869575 13:113550627-113550649 GCACCCAGCCTTCCTCCCTCTGG - Intronic
1114476528 14:22998967-22998989 GCATCTGGCCTCGCTGCCACTGG + Exonic
1114548236 14:23518088-23518110 GGCCCCATCCTTGCTGGCACTGG + Intergenic
1121171870 14:91861444-91861466 GGACCCAGCTTTGCTTTCACTGG + Intronic
1122531070 14:102427419-102427441 GCTGCCAGTCATGCTGCCACTGG - Intronic
1122581821 14:102776479-102776501 GCACCCAGCCTGGCTGGGCCTGG - Intergenic
1122920882 14:104879652-104879674 GCACCCTTCCTTCCTGCCTCTGG - Intronic
1124248954 15:28095154-28095176 GCACTCAGCCGTGCGGCCACGGG - Intronic
1125486517 15:40115054-40115076 GCTCCCAGCTCTGCTACCACAGG + Intergenic
1126799631 15:52287332-52287354 ACACCCATCCTTGTTGCCACGGG + Intronic
1128260634 15:66230352-66230374 TAACCCAGCCCTGCTGCCAGAGG - Intronic
1128703625 15:69822216-69822238 GCACCCCGCTCTGCTGCCACAGG - Intergenic
1128968549 15:72086121-72086143 GCACCCCTCTGTGCTGCCACTGG - Intronic
1132142502 15:99407280-99407302 CCACCCAGCCCTGCTGCACCTGG - Intergenic
1133421839 16:5653064-5653086 GCACCCCACCTTGCTCACACAGG - Intergenic
1133423149 16:5664573-5664595 GCTCCCAGAGTTTCTGCCACAGG + Intergenic
1133514259 16:6492615-6492637 TGACCCAGCCTTTCTGCCTCTGG + Intronic
1133639357 16:7701916-7701938 GCACCCTGGTTTGCTGCAACAGG - Intronic
1133767756 16:8849664-8849686 GCACCCAGCCTGGCAGACTCGGG - Intergenic
1136661838 16:31769681-31769703 GCACCTAGCCAAGTTGCCACTGG - Intronic
1136737637 16:32477762-32477784 GCACTCTGCCCTGCTGCCCCTGG + Intergenic
1137787427 16:51150708-51150730 CCGCCCGGCCTTGCTGCCAGCGG - Intronic
1138510000 16:57503227-57503249 GTGGCCAGTCTTGCTGCCACAGG - Intergenic
1138583514 16:57956544-57956566 GGACACAGCCTTGCAGACACAGG + Intronic
1138635057 16:58331600-58331622 GCTCTCAGCCTGGCTGCCCCTGG + Intronic
1141395918 16:83704558-83704580 GCCCACAGCCCCGCTGCCACAGG + Intronic
1141595134 16:85092763-85092785 GCACCCCGCCTGGCTCGCACAGG + Exonic
1142202199 16:88766611-88766633 ACAGCCAGCTCTGCTGCCACAGG + Intronic
1203015434 16_KI270728v1_random:351815-351837 GCACTCTGCCCTGCTGCCCCTGG - Intergenic
1203033769 16_KI270728v1_random:624973-624995 GCACTCTGCCCTGCTGCCCCTGG - Intergenic
1142471571 17:166023-166045 CGACCCAGCCTAGCTCCCACGGG - Intronic
1142715895 17:1746843-1746865 TCACCCAGCCTGTCAGCCACAGG + Intronic
1145202709 17:20960997-20961019 TCATACAGCCTTGCTGCCACTGG - Intergenic
1145288606 17:21524559-21524581 GCACCCAGCGTTGGTGACATGGG + Intergenic
1147187776 17:38722043-38722065 GCCCCCAGCCCCGCTGCCCCGGG - Exonic
1147399417 17:40171066-40171088 GCAGACAGCCATGCTTCCACAGG - Exonic
1147437252 17:40424607-40424629 TCAGCCAGGCTTGCTGGCACAGG - Intergenic
1148544074 17:48503629-48503651 CCATCCAGCCCTGCTGCCCCTGG + Intergenic
1149850055 17:60028795-60028817 GCCCCCAGCCTAGCCCCCACGGG + Intergenic
1150954008 17:69835469-69835491 GAACCCAGCTTTGCTACCAAAGG - Intergenic
1152018708 17:77769185-77769207 ACCCCCAGCCCTGCTGCCCCTGG - Intergenic
1152562613 17:81086083-81086105 GCCCCAAGCCTTCCTGCCAGCGG - Intronic
1152579190 17:81158591-81158613 GCCCCGAGCCTGGCTCCCACAGG + Intronic
1154084805 18:11293362-11293384 TCACCCAGCCTTGCTGGAGCTGG + Intergenic
1154314764 18:13295979-13296001 GCACCCCGCCTCGCAGCCTCAGG - Intronic
1156475864 18:37405019-37405041 GCACCCAGCCGTTCACCCACGGG + Intronic
1157205185 18:45691940-45691962 GCACCCTGCGGCGCTGCCACAGG + Intergenic
1159047479 18:63383053-63383075 CCACACAGCATGGCTGCCACGGG - Intergenic
1160541773 18:79627813-79627835 CCACCCAGCCGTGCTGCCCTTGG - Intergenic
1162081555 19:8220771-8220793 GCCCTCAGCCTTGATGCCATGGG - Intronic
1163265237 19:16216916-16216938 GCACCCCGCTGTGCTGCCGCTGG - Intronic
1163682749 19:18692701-18692723 TCACCCAGCCCTGCAGCCCCTGG - Intronic
1164502582 19:28832208-28832230 GCACCCAGCCATGCACCCATGGG + Intergenic
1164547623 19:29182175-29182197 GCACCCAGTGTTGATGGCACAGG + Intergenic
1165761152 19:38321711-38321733 TCACCCAGCTCTGCTGCCAGGGG - Intronic
1166908623 19:46134136-46134158 ATTCACAGCCTTGCTGCCACAGG - Intergenic
1166918017 19:46209039-46209061 GCTCCCAGCCTTGCTCACCCTGG + Intergenic
1167272024 19:48511314-48511336 GCCCCCAGCCTCCCTCCCACAGG + Intronic
925462232 2:4073563-4073585 GCAGACAGCCCTGCTGCCATGGG + Intergenic
926112622 2:10192748-10192770 CCACCCCCCCCTGCTGCCACAGG + Intronic
926957555 2:18318024-18318046 GCACCCAGCCTTGGTGACAGAGG + Intronic
927086087 2:19675133-19675155 GCACACAGCCTTGCTTCAAAAGG + Intergenic
927203265 2:20591476-20591498 ACACCTGGCCTTGGTGCCACGGG - Intronic
927672679 2:25082254-25082276 GCAGCCAGGATTGCGGCCACAGG + Intronic
929088741 2:38194090-38194112 GCACCCATCATTGCTCCCCCTGG + Intergenic
929234074 2:39588354-39588376 GTGCCCAGCTTTGCTGCCATAGG + Intergenic
930505044 2:52273072-52273094 GCACTCAGCCTGGGTGACACAGG - Intergenic
931218433 2:60267295-60267317 GCACCCAGCACTGCTGACCCAGG + Intergenic
931430162 2:62202901-62202923 GCCCCCAGCTTTCCTGCCTCTGG + Intronic
931640148 2:64374738-64374760 TCACTCAGCCTTGCTGGAACAGG - Intergenic
932659731 2:73641741-73641763 GCTCCCAGCCTTGCAGGAACAGG + Intronic
932666299 2:73701419-73701441 GCTCCCAGCCTTGCAGGAACAGG + Intergenic
933795364 2:85915173-85915195 GCTCCCTTCCTTGTTGCCACAGG - Intergenic
933842526 2:86298857-86298879 GCACTCTGCCTTGCTGACCCAGG - Intronic
934188761 2:89766875-89766897 GCACTCTGCCCTGCTGCCCCTGG + Intergenic
934307831 2:91841078-91841100 GCACTCTGCCCTGCTGCCCCTGG - Intergenic
934492861 2:94773629-94773651 GCAGCAACCCTTGCTGTCACAGG - Intergenic
934763376 2:96868292-96868314 GCAGCAGGCCTTGCAGCCACTGG + Intronic
938069255 2:128299909-128299931 CCACCCTGCCTTGCTGGCGCTGG - Intronic
938415693 2:131101959-131101981 GCACCCAGCCTTCTTTCCCCTGG + Intergenic
938721279 2:134069265-134069287 CCACCATGCCTGGCTGCCACTGG - Intergenic
941347856 2:164391927-164391949 TCACCCAGCATAGCTGCCATGGG - Intergenic
941965311 2:171294908-171294930 GAACCATGCCTTGCTCCCACTGG - Intergenic
944110641 2:196128406-196128428 GTATCAAGCCTTGCTGCCAAAGG - Intergenic
944318023 2:198304430-198304452 GCCATCAGCCTTGCTGGCACAGG + Intronic
947793530 2:232880727-232880749 GCACCGAGCCTGGCAGTCACAGG + Intronic
948236336 2:236393807-236393829 GCACCAAGCTGTGCTGCCCCAGG - Intronic
948638847 2:239360442-239360464 GCACCCTGCCTTCCTGCAGCAGG + Intronic
948727232 2:239942311-239942333 GCACCCAGGCCTGCTGGCTCAGG - Intronic
948922499 2:241072311-241072333 CCCATCAGCCTTGCTGCCACCGG - Intronic
1170481128 20:16765962-16765984 GCACAGTGCCTTTCTGCCACAGG + Intronic
1173647790 20:44644395-44644417 GCACCCAGCATTGCTGACATGGG - Intronic
1173841754 20:46161951-46161973 GCACCCATCCTTGATGCCCTAGG - Intergenic
1175624232 20:60477077-60477099 GCACCCAGCCTTGCTGGACATGG + Intergenic
1177942153 21:27424396-27424418 GAATGCAGCCTTGTTGCCACTGG - Intergenic
1179486974 21:41716730-41716752 GAACCCGGCCCTGCTGACACTGG + Intergenic
1179885533 21:44312801-44312823 GGATCCAGCCATGCTGCCACAGG + Intronic
1180228229 21:46411005-46411027 ACACCCACCTTGGCTGCCACTGG - Intronic
1180534917 22:16388160-16388182 GCACTCTGCCCTGCTGCCCCTGG - Intergenic
1181040032 22:20187771-20187793 CCACCCAGCCATGCAGCCTCAGG - Intergenic
1181307835 22:21927044-21927066 GCACCCAGCCTACCAGGCACTGG - Intronic
1181625295 22:24118811-24118833 ACACCCAGCCTTGCTCCACCAGG - Intronic
1182298037 22:29321400-29321422 GCGCCCAGCCTGGCTGCTCCTGG + Intergenic
1183368059 22:37417591-37417613 CCACCCAGCTTTCCTTCCACAGG - Intronic
1184176382 22:42791870-42791892 GCCCCCAGCCTGGCTGAGACGGG - Intergenic
1184334896 22:43847424-43847446 GCACCCAGCACTCCTCCCACTGG + Intronic
949989559 3:9567639-9567661 GCACCCAGCCTGGGTGACAAAGG + Intergenic
950578188 3:13845719-13845741 GCACCCAGCCCTACTGCCTGTGG + Intronic
951640169 3:24827936-24827958 GCAGCCAGCCTTGCAATCACCGG + Intergenic
952833325 3:37583772-37583794 ACACCCAGCCTTGTTCCAACAGG - Intronic
952967333 3:38629438-38629460 GCACTCACCCTGGTTGCCACTGG + Intronic
953179656 3:40583822-40583844 ACCTCCAGCCTTGCTGCTACAGG - Intergenic
953607653 3:44421950-44421972 GCACCAAGCCTTCCTGGAACAGG + Intergenic
954305954 3:49725447-49725469 GCCCCCAGCCCTGGTGCCACTGG - Exonic
956157933 3:66317941-66317963 CCACCCGGTCTTGCTGGCACTGG + Intronic
961144708 3:124584516-124584538 GCCCACAGCGTTGGTGCCACAGG + Intronic
961645976 3:128392987-128393009 GAGCCCAGCCTTGCTGTCAGAGG + Intronic
961675226 3:128560872-128560894 GCCGCCAGCCCTGCTGCCACTGG - Intergenic
962160377 3:132992907-132992929 ACCCCAAACCTTGCTGCCACAGG - Intergenic
967068695 3:185943146-185943168 GCCCCTGGCCTGGCTGCCACTGG - Intergenic
968746368 4:2362609-2362631 GCCCCCAGCCTGGCAGCCCCTGG - Intronic
968917666 4:3503932-3503954 GCACCCAGTGCTGCTGCCCCAGG + Intergenic
969871545 4:10107843-10107865 GCACCCAGCCCTGCCAACACAGG + Intronic
972289362 4:37677231-37677253 GGATCCAGCCTTGCTGCCTATGG - Intronic
982460976 4:155667865-155667887 GCCTCCAGCCCTGCTGCCTCCGG - Intronic
983381710 4:167003988-167004010 TCACCTACCCTTGCTGCCTCAGG + Intronic
984041782 4:174744155-174744177 CAACCCAGCATTGCAGCCACTGG + Intronic
985656689 5:1135489-1135511 GTCCCCAGCCCTGCTGCCCCGGG + Intergenic
988296172 5:29365577-29365599 CCACCCAGTCTTGGTGCCCCTGG + Intergenic
993331977 5:86612076-86612098 CCACCCAGCCATGCTGTCTCTGG + Intergenic
996047712 5:118894005-118894027 GCACCCAGCCTGGGTGACAGAGG + Intronic
997984489 5:138492029-138492051 GCACCGAGCCTCGCAGCCGCGGG - Intergenic
1001077023 5:168637552-168637574 GCACCCCTCCTTTCTGCCAAGGG - Intergenic
1002502919 5:179658728-179658750 TCCCCCAGCCTTGCTGGCAGTGG + Intergenic
1002912951 6:1505231-1505253 ACACCCAGACTGGCTGCCTCAGG + Intergenic
1003736883 6:8887265-8887287 GCAGCCAGCCCTGCTGGCCCCGG + Intergenic
1006984764 6:38169133-38169155 GCACCCTGCCCTGCTGACCCTGG + Exonic
1012876044 6:104727923-104727945 GCACCTAGCCTTCCAACCACAGG + Intergenic
1014001216 6:116368845-116368867 ACACCTAGCCTTGATTCCACAGG - Intronic
1016782115 6:147970521-147970543 GCACTTAGTCTTACTGCCACTGG - Intergenic
1018914840 6:168126873-168126895 GGAGCCAGCCTTGCTGCAGCCGG - Intergenic
1024137146 7:46421483-46421505 GCACCAAGCCAGGGTGCCACAGG + Intergenic
1024295277 7:47836790-47836812 GCAGCCAGGCTTGCTTCCCCTGG + Intronic
1024861189 7:53843419-53843441 ACACTCACCTTTGCTGCCACAGG - Intergenic
1026208511 7:68280348-68280370 CCACCCAGAGCTGCTGCCACGGG + Intergenic
1028061276 7:86320193-86320215 GCACCCAGCATTGCTGCAGAAGG - Intergenic
1029889652 7:103914034-103914056 GCACCTAGCCTTCCTCTCACAGG - Intronic
1030065001 7:105652689-105652711 GCTCCCAGCCTTCCTGGCAGGGG - Intronic
1031847513 7:126824220-126824242 TCACCCAGGCTGTCTGCCACTGG - Intronic
1032080698 7:128857088-128857110 GCCCTCAGCCTTGCTACCTCTGG + Intronic
1032091554 7:128914071-128914093 GCCCTCAGCCTTGCTACCTCTGG - Intergenic
1034057280 7:148048491-148048513 TCACCCAGCCTCCCTGCCATTGG - Intronic
1034446904 7:151118410-151118432 ACACACAGCCTTGCTCTCACTGG - Intronic
1034496711 7:151427549-151427571 GGACCCAGCCTTGCTGGGGCTGG - Intergenic
1035305340 7:157928235-157928257 ACACTCAGCCATGCTGCCCCCGG + Intronic
1035419239 7:158713001-158713023 GGACCCAGCCAGGCAGCCACGGG + Intergenic
1036391838 8:8330510-8330532 TCACTCAGCCTTGCTGCCAGGGG - Intronic
1038258407 8:25971904-25971926 GCGCCCAGCCTTGCAGCCCAGGG - Intronic
1039793194 8:40891607-40891629 GCACCCTGCCCTGCTGCCTGAGG + Intronic
1040103325 8:43524218-43524240 GCAGCCACCCTTACTGTCACAGG + Intergenic
1043677889 8:82982487-82982509 GCACCCAGTGTTGCTGTCATTGG + Intergenic
1044233693 8:89806969-89806991 GCACCCCGCCTTCCTGACCCTGG + Intergenic
1044327512 8:90876174-90876196 GCACTCAGACTTGCTGGCACAGG - Intronic
1048918342 8:139204988-139205010 GCACTCACCCTTGTTGCCAGAGG + Intergenic
1053663887 9:40304052-40304074 GCAGCAACCCTTGCTGTCACAGG + Intronic
1053914427 9:42935308-42935330 GCAGCAACCCTTGCTGTCACAGG + Intergenic
1054376013 9:64450286-64450308 GCAGCAACCCTTGCTGTCACAGG + Intergenic
1054520726 9:66072233-66072255 GCAGCAACCCTTGCTGTCACAGG - Intergenic
1057726630 9:97572727-97572749 GGACAGAGACTTGCTGCCACAGG - Intronic
1058898966 9:109424866-109424888 GAACCCAGCCCTGCTGGCATTGG + Intronic
1060536567 9:124393982-124394004 ACACCCTGCCCTGCTGCCGCAGG + Intronic
1060666743 9:125436332-125436354 GAGCCCAGCCTTGCTTCCAGTGG - Intergenic
1061671809 9:132193015-132193037 GCACCCGGCCTGTCTGTCACTGG - Intronic
1062428159 9:136515541-136515563 CCAGCCAGCCCTGCCGCCACGGG - Exonic
1062647502 9:137556372-137556394 CCACCCAGCCTTGCAGCCCCTGG - Intronic
1062656718 9:137607417-137607439 GCACCCAGCCGTGAGGACACCGG + Intronic
1188526734 X:31095379-31095401 GCACCCAGCCTGACTTCCAATGG - Intergenic
1192149067 X:68700606-68700628 GCAGCCAGCCTTTCTGCTCCAGG + Intronic
1193218785 X:78898324-78898346 CCCCCCAGCCCTGCTACCACTGG - Intergenic
1195197714 X:102516275-102516297 GCGCCCAGCCTAACGGCCACGGG + Intronic
1195571322 X:106401529-106401551 GCACCTAGCCTTGCAGTAACAGG + Intergenic
1199173381 X:144757465-144757487 CCACGCAGTCTTGCTGGCACCGG + Intergenic
1200111039 X:153741012-153741034 GCACTCCGCCCTGCTGCCCCTGG - Intronic