ID: 901602149

View in Genome Browser
Species Human (GRCh38)
Location 1:10430673-10430695
Sequence CGCAGCCGCGGGGGGCGCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 369
Summary {0: 2, 1: 0, 2: 2, 3: 40, 4: 325}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901602149_901602160 11 Left 901602149 1:10430673-10430695 CCCGGGCGCCCCCCGCGGCTGCG 0: 2
1: 0
2: 2
3: 40
4: 325
Right 901602160 1:10430707-10430729 TTAACTGCCGCGGGTGGTGCTGG 0: 1
1: 0
2: 0
3: 4
4: 48
901602149_901602158 2 Left 901602149 1:10430673-10430695 CCCGGGCGCCCCCCGCGGCTGCG 0: 2
1: 0
2: 2
3: 40
4: 325
Right 901602158 1:10430698-10430720 TGCGTTGGCTTAACTGCCGCGGG 0: 1
1: 0
2: 0
3: 1
4: 17
901602149_901602165 27 Left 901602149 1:10430673-10430695 CCCGGGCGCCCCCCGCGGCTGCG 0: 2
1: 0
2: 2
3: 40
4: 325
Right 901602165 1:10430723-10430745 GTGCTGGGAGGCGGTTTCCGCGG 0: 1
1: 0
2: 3
3: 9
4: 157
901602149_901602161 12 Left 901602149 1:10430673-10430695 CCCGGGCGCCCCCCGCGGCTGCG 0: 2
1: 0
2: 2
3: 40
4: 325
Right 901602161 1:10430708-10430730 TAACTGCCGCGGGTGGTGCTGGG 0: 1
1: 0
2: 0
3: 2
4: 46
901602149_901602157 1 Left 901602149 1:10430673-10430695 CCCGGGCGCCCCCCGCGGCTGCG 0: 2
1: 0
2: 2
3: 40
4: 325
Right 901602157 1:10430697-10430719 ATGCGTTGGCTTAACTGCCGCGG 0: 1
1: 0
2: 0
3: 0
4: 22
901602149_901602162 15 Left 901602149 1:10430673-10430695 CCCGGGCGCCCCCCGCGGCTGCG 0: 2
1: 0
2: 2
3: 40
4: 325
Right 901602162 1:10430711-10430733 CTGCCGCGGGTGGTGCTGGGAGG 0: 1
1: 0
2: 2
3: 34
4: 327
901602149_901602159 5 Left 901602149 1:10430673-10430695 CCCGGGCGCCCCCCGCGGCTGCG 0: 2
1: 0
2: 2
3: 40
4: 325
Right 901602159 1:10430701-10430723 GTTGGCTTAACTGCCGCGGGTGG 0: 1
1: 0
2: 0
3: 2
4: 35
901602149_901602164 18 Left 901602149 1:10430673-10430695 CCCGGGCGCCCCCCGCGGCTGCG 0: 2
1: 0
2: 2
3: 40
4: 325
Right 901602164 1:10430714-10430736 CCGCGGGTGGTGCTGGGAGGCGG 0: 1
1: 0
2: 1
3: 51
4: 433

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901602149 Original CRISPR CGCAGCCGCGGGGGGCGCCC GGG (reversed) Intronic
900168457 1:1254471-1254493 TGCAGCACCGAGGGGCGCCCAGG + Intronic
900199771 1:1399237-1399259 CGCGGCAGCGGCCGGCGCCCCGG - Exonic
900346617 1:2213410-2213432 TGTAGCCGCGAGGGGCTCCCTGG + Intergenic
901242604 1:7704162-7704184 CGCCGCCGCAGGGCGCGCCGGGG + Intronic
901556066 1:10032625-10032647 CGGAGGCGCGGCGGGCCCCCGGG + Intergenic
901602149 1:10430673-10430695 CGCAGCCGCGGGGGGCGCCCGGG - Intronic
901805490 1:11736159-11736181 CGCAGCCGCGGGGGGCTCCTAGG - Exonic
903142161 1:21345294-21345316 CGGTGCCGCGGGTGGCACCCGGG - Intronic
903153340 1:21428424-21428446 CGCCGCCGCCGGGCGCGCCCAGG - Intergenic
904006593 1:27366323-27366345 CGCAGCTGCGGGGGCGGCCGCGG + Exonic
904641958 1:31937950-31937972 CGCCGGCGCGGGGGCCGCCCGGG + Intronic
904746144 1:32712386-32712408 CGCAGCCGCGCGGGGCCGCCCGG + Intergenic
904782979 1:32964503-32964525 CGCAGCCGGGGGCGGCGGCTCGG + Exonic
905308408 1:37034137-37034159 CGCGGCCGTGGCGGGCTCCCTGG + Intergenic
905345465 1:37308301-37308323 CGCTGCCGCGTGGGGGGCCACGG - Intergenic
905390865 1:37634646-37634668 CGCAGGCGAGCCGGGCGCCCAGG - Exonic
905630458 1:39515385-39515407 CGCATCCGCGCGGGGGGCGCCGG + Intronic
905667303 1:39770804-39770826 CGCATCCGCGCGGGGGGCGCCGG - Exonic
906263160 1:44407918-44407940 CGCAGCCGCGCGGGGCCCGCGGG - Intronic
906365422 1:45205978-45206000 CGCCGGCGCCGGGGCCGCCCCGG + Exonic
906805599 1:48776648-48776670 CCCAGTCGCGGGGGGCGCGCGGG + Exonic
908401135 1:63774062-63774084 CGCCGCCGCCGAGGGAGCCCCGG + Exonic
910251354 1:85201452-85201474 GGCAGCCGCGGGAGACGCCTGGG - Intergenic
910676434 1:89821137-89821159 GGCAGCCGCGGGCGGGGCCGCGG + Exonic
911219720 1:95234121-95234143 CGGAGGCGCGGGGCGCCCCCGGG + Intronic
912354267 1:109042180-109042202 CCCCGCCGCGCGGGGCGGCCAGG + Intergenic
913186464 1:116373864-116373886 TGCAGCAGCGGGGGCGGCCCCGG + Exonic
913578011 1:120196946-120196968 GGCAGCCGCGGAGGAGGCCCAGG + Intergenic
913630161 1:120701406-120701428 GGCAGCCGCGGAGGAGGCCCAGG - Intergenic
914559927 1:148808366-148808388 GGCAGCCGCGGAGGAGGCCCAGG + Intronic
914612906 1:149321849-149321871 GGCAGCCGCGGAGGAGGCCCAGG - Intergenic
914854749 1:151342903-151342925 CACAGCTGCTGGGGGTGCCCCGG + Exonic
915127924 1:153678900-153678922 CGCGACCGAGGGGGGCGCGCAGG - Exonic
917788827 1:178486848-178486870 CGCGGCCCCGGGGGGCACCTTGG - Intergenic
920351968 1:205343605-205343627 GGCAGCCTTGGGGAGCGCCCGGG + Exonic
920886872 1:209938122-209938144 TGCGGCCGCGAGGGGCGCCGCGG - Intergenic
923126737 1:231040179-231040201 CGCGGCCCCGGGCGCCGCCCGGG + Exonic
923141479 1:231163782-231163804 CGCCTCCGCTGGGGGCGCCCTGG - Exonic
924527429 1:244864398-244864420 CGCAGCCGCAGCCGCCGCCCGGG - Exonic
1064553109 10:16521711-16521733 CGCCGCCGCTGGGCGCACCCGGG - Exonic
1065520594 10:26567337-26567359 GGCCACCGCGGGGGGCGGCCTGG - Exonic
1066094019 10:32055980-32056002 CGCAGCCGGGGCCGGCGGCCGGG + Exonic
1066590560 10:36989506-36989528 AGCAGCTGCGGAGGGTGCCCTGG - Intergenic
1069994097 10:72332192-72332214 TGCAGCCGCGGGAGGGGCCTGGG + Intergenic
1070147556 10:73785836-73785858 CGGATCCGCGGGGGGGGACCCGG + Exonic
1070167774 10:73911352-73911374 GGCACCCGCGGGGGACGCCCGGG - Exonic
1070610074 10:77926814-77926836 CCCGGCCTCGGGGCGCGCCCCGG - Intergenic
1071695287 10:87863508-87863530 CGCCGCCGCGCCGGGAGCCCGGG - Exonic
1072719507 10:97771944-97771966 CGCCGCCGCGGAGGTCGCCCAGG + Exonic
1074814504 10:117134310-117134332 CGCAGCCGCCGCCGCCGCCCCGG - Exonic
1075802002 10:125159868-125159890 AGCAGGAGCCGGGGGCGCCCAGG + Intronic
1075885544 10:125896357-125896379 CGGGGCCGCGGGGGCCGCCAGGG + Intronic
1076116821 10:127906959-127906981 CGCAGGTGGGGCGGGCGCCCTGG + Intergenic
1076130624 10:128011456-128011478 CGCACCCGCCTGGTGCGCCCAGG - Intronic
1076348045 10:129794171-129794193 CGCAGCCGCGCTGTGCACCCAGG + Intergenic
1076371571 10:129959222-129959244 CGCAGGCCTGGCGGGCGCCCGGG - Intronic
1076657850 10:132036582-132036604 CGCGGCCGCGGGGACCGCCCGGG + Intergenic
1076781827 10:132728817-132728839 AGCAGCCGCGGGAGCCTCCCTGG + Intronic
1076792926 10:132786258-132786280 CGCGGCCGGCGGGGGCGCGCGGG - Intergenic
1077068416 11:655538-655560 CGCAGCTGCGGGAGGGGCCGTGG + Intronic
1077144056 11:1036985-1037007 CCCAGCAGCGGGGAGGGCCCGGG - Intergenic
1077160099 11:1108747-1108769 CGCAGCTGTGATGGGCGCCCTGG + Intergenic
1077247593 11:1547051-1547073 CGGACCCGCGAGGGGCGCGCAGG + Intergenic
1077320456 11:1938629-1938651 CACAGACGCGGGGGACGCCCCGG - Exonic
1077322311 11:1947797-1947819 CGCTGCGGTGGGGGCCGCCCGGG - Intronic
1077342095 11:2030730-2030752 AGCAGCCGCCTGGGGAGCCCCGG - Intergenic
1077360979 11:2139968-2139990 CGCGGCACCGGGGGGCGCTCGGG - Intronic
1078934268 11:15938309-15938331 CGCAGGAGCGGGGGGAGCCGCGG - Intergenic
1079459758 11:20669465-20669487 CGCAGCCGCAGCGGGGGGCCGGG + Intergenic
1079689412 11:23403546-23403568 CGCCGCCGCGGGACGGGCCCAGG + Intergenic
1080551349 11:33376260-33376282 GGCGGCCGCGGGGCGCGCTCGGG - Intergenic
1081528527 11:43942886-43942908 CGCAGACGCCGGAGGCGCCATGG + Exonic
1081831503 11:46119962-46119984 GGCGGCCGCGGGGCGCCCCCGGG - Intronic
1083970313 11:66070415-66070437 CGCCGCCGCGGGGGAAGCCTGGG + Intronic
1087175201 11:95089772-95089794 CGGAGCCGGGCGGGGCGGCCCGG - Intergenic
1089398861 11:118153029-118153051 CGCAGCGGGCGGGGGCTCCCCGG - Intergenic
1089432657 11:118436567-118436589 GGCGGCGGCGGGGGGCGCCGGGG + Exonic
1202805329 11_KI270721v1_random:3110-3132 CGCTGCGGTGGGGGCCGCCCGGG - Intergenic
1202825081 11_KI270721v1_random:85919-85941 AGCAGCCGCCTGGGGAGCCCCGG - Intergenic
1092094154 12:5827899-5827921 GGCAGGGGCGGGAGGCGCCCGGG + Intronic
1092193200 12:6534650-6534672 CGCCGCTGCGGGGTGGGCCCGGG + Intronic
1094567869 12:31616482-31616504 CGCGGCCCCGGAGGGAGCCCCGG + Intergenic
1095812239 12:46383477-46383499 CGCAGAGGCGGGCTGCGCCCGGG - Intergenic
1096396553 12:51270381-51270403 GGAAGCCGCGGGTGGCGCGCGGG + Exonic
1097891371 12:64780821-64780843 CCCACCGGCGGGGGCCGCCCGGG + Intergenic
1097990256 12:65825585-65825607 GGGAGCCGCGGCGGGCGGCCCGG + Intronic
1101466926 12:104958370-104958392 CGCCGCCGCCGGGGAAGCCCGGG + Intronic
1102997448 12:117361207-117361229 CGCGGCGGCCGCGGGCGCCCGGG - Intronic
1103088926 12:118083629-118083651 CCCAGCTGCTGGGGGCGCCTGGG - Intronic
1103364012 12:120369332-120369354 CGCCGCCTCCGCGGGCGCCCGGG - Intergenic
1103521259 12:121537955-121537977 CGCAGCCGAAGGGGACGCCCGGG - Intronic
1103764546 12:123271313-123271335 CGCCGGCGCGGGGGTCACCCCGG + Intronic
1104831647 12:131756556-131756578 CGCAGCCGAGGTGGGAGCACGGG + Exonic
1104949474 12:132432757-132432779 CGGAGCCGCCGGGGGCCTCCAGG - Intergenic
1108648196 13:52450733-52450755 CGCGGCTGCGAGGTGCGCCCGGG + Intergenic
1112183963 13:97110818-97110840 CGCAGCCCTGGAGGGCACCCAGG + Intergenic
1112197801 13:97242686-97242708 CCCAACCCCGGGGGGCTCCCGGG - Intronic
1112216315 13:97434311-97434333 CGCCGCCGCCGCCGGCGCCCAGG + Exonic
1112580635 13:100674380-100674402 CGCAGGCGCCGGGTGCGCCCGGG + Intronic
1113493770 13:110712923-110712945 CGCAGGCGCGGGAGCCGCCTAGG + Intronic
1113656157 13:112068705-112068727 CGCCGGCGAGGGGGGCGACCCGG + Exonic
1113861488 13:113490434-113490456 CGGAGCCGCGAGGGACGACCGGG - Intronic
1115474416 14:33800062-33800084 CGCAGGCGAGGCGGGCGCGCAGG + Exonic
1116437604 14:44912315-44912337 AGCAGCTGCGGAGGGTGCCCCGG + Intergenic
1118024074 14:61751197-61751219 CGGGGCCGCGGGCGGGGCCCGGG - Intergenic
1118332186 14:64823446-64823468 CCCCGCCGCGGGGAGCACCCCGG + Intronic
1122130877 14:99604107-99604129 CGCGCCCGCCGGGGCCGCCCGGG + Intergenic
1122162443 14:99793808-99793830 AGCACCCGCGGAGCGCGCCCGGG + Intronic
1122216531 14:100208382-100208404 AGCAGCTGCGGAGGGCGCACCGG - Intergenic
1122399542 14:101458704-101458726 CGAGGCCGCGGGGGGCGCCGCGG - Intergenic
1122917487 14:104865669-104865691 CGCCGCCGCGGAGGCGGCCCTGG + Intronic
1123004604 14:105315142-105315164 CGGGGGCGCGGGGGGCGACCTGG - Exonic
1202872522 14_GL000225v1_random:177583-177605 CGGGGCCGCGGGGGCCGCCAGGG - Intergenic
1124128925 15:26967903-26967925 CGCAGCTGCGCGGGCAGCCCAGG + Intergenic
1125536115 15:40441762-40441784 CGCGGCCGGGGGCGGCGCCGCGG + Intronic
1125674252 15:41494071-41494093 CGCCGCCGCGGGGGAGCCCCGGG + Exonic
1126134679 15:45378589-45378611 TGGGGCCGCGGGGGGCGGCCGGG - Exonic
1126649636 15:50908252-50908274 CGGAGCCGCGCGCGGCGCCGGGG + Intergenic
1128453626 15:67821203-67821225 CCCGGCCGCGGGGGGCCCCCAGG - Intronic
1129161613 15:73751195-73751217 CCCAGCCGAGGGGGGCTCCGTGG - Exonic
1129360032 15:75018893-75018915 CGCAGCCATGGGGGCAGCCCAGG + Exonic
1131735495 15:95327025-95327047 CCGAGCCGCGGGGGCCGCCGAGG + Intergenic
1132163882 15:99566221-99566243 CGCGGCCGAGAGGGTCGCCCGGG + Intronic
1132275375 15:100559021-100559043 CGCAGCCTCGGAGGGCGGCGTGG + Intergenic
1132398233 15:101489577-101489599 CGCGGGCGCGGGGGGCGCGGGGG - Exonic
1132512823 16:352692-352714 CGCCGCCGGCGGGGGCGCTCGGG - Intergenic
1132522223 16:397121-397143 CGGGGCGGCGGGGGGCTCCCGGG + Intronic
1132734655 16:1379480-1379502 GACAGCCGCGGGGTGGGCCCGGG - Intronic
1132781134 16:1626274-1626296 CGCCACTGCGGGGGTCGCCCAGG - Intronic
1132889534 16:2196885-2196907 CGCGGCCGCCGGGGGTGCACTGG + Intergenic
1132932233 16:2464559-2464581 CACAGCCGCAGGGGCCGCCCTGG + Exonic
1135480079 16:22814645-22814667 CTCAGCCGCGGAGGGCGCGCAGG + Exonic
1136141640 16:28292540-28292562 CGCAGCCCGGGCGGGCGCCGGGG + Exonic
1137300593 16:47144220-47144242 AGCCGCCGCGCAGGGCGCCCGGG + Intergenic
1137617088 16:49854963-49854985 CCCCTCCGCGGAGGGCGCCCCGG - Intronic
1137617354 16:49855818-49855840 CGGAGCGGCGGGGGGCGGCGGGG - Intronic
1139826624 16:69762400-69762422 CGCTGGCGCGGGGGGCGCGGTGG + Intronic
1141593003 16:85081110-85081132 CGCAGCCGCTGGGAGCCCCAGGG + Intronic
1142240047 16:88940919-88940941 CGCAGCCGCGCCGAGCGCACGGG - Intronic
1142631689 17:1229784-1229806 CGCGGCGGGGGCGGGCGCCCCGG + Intergenic
1142695234 17:1629448-1629470 TGCATCAGCGGGGGGCGCCACGG - Intergenic
1143058026 17:4176938-4176960 CGCAGCCCAGTGGGGCGCTCAGG + Intronic
1143148191 17:4789914-4789936 AGCAGCCGGGGGCGGCCCCCCGG + Exonic
1143155533 17:4833777-4833799 CCCAGCCGCGGCGGGAGTCCGGG - Intronic
1143211567 17:5191864-5191886 CGCAGTCCCGGGGAGCGCACCGG - Intronic
1144339370 17:14299668-14299690 CTCAGCCCCGGGGGTCGCGCTGG + Intergenic
1144756081 17:17681530-17681552 CGCGGGCGGGGGCGGCGCCCGGG - Exonic
1146251159 17:31345454-31345476 CGCGGCCCCGGAGGGAGCCCCGG - Intronic
1146271452 17:31488225-31488247 CGCATCCGCGGGCCGCTCCCCGG - Intronic
1146445326 17:32928201-32928223 GGCAGTCGCGGGATGCGCCCGGG + Exonic
1146794300 17:35770301-35770323 CCCACCTGCAGGGGGCGCCCTGG - Exonic
1147139654 17:38453953-38453975 CGCGGCCGGCGGGGGCTCCCGGG - Intronic
1148323535 17:46771214-46771236 CGCAGGCGCGGGGCGCGGGCGGG - Intronic
1149614752 17:57988293-57988315 CGCGGGCGGGGGGGGAGCCCCGG + Intergenic
1149855455 17:60078855-60078877 TGCAGCCGCGGGAGGCACCGCGG - Exonic
1149891337 17:60392408-60392430 CGCAGCCGCGCGCCCCGCCCGGG + Intronic
1150488871 17:65561256-65561278 CGGGGCTGCGGGGGGCGGCCCGG - Intronic
1150802363 17:68291900-68291922 CGCAGCCGCGAGCGCCGCGCGGG - Intronic
1151707633 17:75779224-75779246 CGCAGCCCTGGGGGGCGGCCCGG - Intronic
1152197414 17:78925589-78925611 CGCACCCGCGCGGGGGTCCCCGG + Intergenic
1152617057 17:81342858-81342880 CTGAGCCGAGTGGGGCGCCCAGG - Intergenic
1152656838 17:81523769-81523791 CTCAGCCGCGGGGTGGCCCCAGG + Intronic
1152809591 17:82375303-82375325 CGCGGCCGCGTGCGGGGCCCGGG + Exonic
1153489280 18:5630593-5630615 CGCAGCTGCGGGAGGAGCCCGGG - Intronic
1155199349 18:23503587-23503609 CGCGCCCGCGGCGGGGGCCCCGG - Exonic
1156036151 18:32770277-32770299 CGCCGCCGCAGGAGGAGCCCGGG - Exonic
1157529543 18:48409510-48409532 CGCCGGCTCGGGGGGCGCACAGG + Intronic
1157529584 18:48409671-48409693 CGGCGCGGCGGGGGGCGCCCGGG + Intronic
1157815912 18:50729490-50729512 CGTGGCCGTGGGGGGCGCGCCGG - Exonic
1160242393 18:77132898-77132920 CGCGGCCGCCGGCGCCGCCCCGG + Intronic
1160256132 18:77250245-77250267 CGCAGCGGGCGGAGGCGCCCGGG + Intergenic
1160860935 19:1237022-1237044 CGCAGCCGGGTGGGGAGGCCCGG + Intronic
1160904646 19:1446424-1446446 CGCGGCGGCGGGGGGCGCATGGG + Intronic
1160928049 19:1556312-1556334 CGGGGGCGCTGGGGGCGCCCAGG + Exonic
1161056163 19:2191593-2191615 TGCAGCCGTGGGTGGGGCCCGGG - Intronic
1161284948 19:3464068-3464090 CGGAGGCGTGGGGGGCGCACCGG - Intronic
1161313137 19:3606212-3606234 TGCAGCCGGGGAGGGGGCCCAGG - Intronic
1161380281 19:3961193-3961215 CGCGGCCGTGGTGGGAGCCCAGG - Intronic
1161628418 19:5339765-5339787 CGCAGCCCCCGGGGGCTCCCGGG + Intronic
1162019930 19:7863735-7863757 CGCAGCCGCGGGGGGCGCCCGGG + Intronic
1162802320 19:13118364-13118386 CGGCGCAGCGGGGCGCGCCCCGG + Exonic
1163314215 19:16531461-16531483 CGCAGCGGCAGGGGCCTCCCAGG - Intronic
1163509603 19:17726991-17727013 CCCAGCCGCGGGAGGTGCGCCGG + Exonic
1163583021 19:18149430-18149452 CGCAGCCGCGGGGATCGGGCAGG - Exonic
1163607067 19:18281365-18281387 CGCGGCCGTCGGGGGCGCCCCGG + Exonic
1163715651 19:18870647-18870669 GGCGGCCGCGTGGGGCTCCCAGG - Intronic
1164492451 19:28727503-28727525 CGGCCCCTCGGGGGGCGCCCGGG - Intergenic
1165089296 19:33374165-33374187 GCCCGCCGCGAGGGGCGCCCCGG - Intronic
1165851400 19:38852071-38852093 CGCCGGCGCGAGGGGCGTCCGGG - Intronic
1166100355 19:40567976-40567998 CGCCGCCGCGGGGGTCGCGGGGG - Exonic
1166126304 19:40717179-40717201 GGCCGCCGCGGGCAGCGCCCCGG - Exonic
1166193711 19:41193216-41193238 CCCAGCCGCGCGGAGCGCCTGGG + Exonic
1166679537 19:44758402-44758424 CGCAGCCGCAGGGTGAGCCGGGG + Exonic
1166802583 19:45467618-45467640 CGCAGGCGCGGGCGGGGCGCGGG + Intronic
1166852821 19:45768614-45768636 AGCGGCCTCGGGGGGCGACCCGG + Exonic
1166852840 19:45768668-45768690 CGCAGCCGCTGCGCCCGCCCCGG + Exonic
1167145719 19:47680091-47680113 CGGAGGCGCGGGGGCCGCCTCGG + Exonic
1167613478 19:50518298-50518320 GGCAGCGGCGGGGGCGGCCCTGG - Exonic
1168154520 19:54465347-54465369 GGCCCCCGCGGGGGGCGCCCGGG + Exonic
1168588569 19:57614430-57614452 CGGAGCCGCGAGGGGGTCCCAGG - Exonic
1168689709 19:58369109-58369131 TGCAGCCTCGGGGTGAGCCCCGG - Exonic
925128421 2:1477619-1477641 CGCAGCCACCCAGGGCGCCCAGG - Intronic
929138016 2:38643274-38643296 AGCAGCTGCGGAGGGTGCCCTGG - Intergenic
931348999 2:61471358-61471380 CGCGGCCGCGGGGGGAGTCCGGG + Intergenic
932812279 2:74835056-74835078 CGCTGCCGCGTGGGGCCGCCGGG + Intronic
933741682 2:85538988-85539010 CGCGGCCGCGGGAGGTGCCGTGG - Intergenic
936038304 2:109129572-109129594 CGCAGCAGCGGCGGCCGCCTTGG - Exonic
936433268 2:112482241-112482263 CCGGGCCGCGGCGGGCGCCCGGG + Exonic
937369043 2:121285151-121285173 CGCAGACGCGGGGCGCGCCGAGG + Exonic
938073043 2:128318419-128318441 CGCGGCCGCCGGGCGCGCCCAGG + Exonic
942151064 2:173076156-173076178 CGCCGCCGCCGGGCGGGCCCTGG - Intronic
942450911 2:176107614-176107636 GGCAGCAGCGGGGGCGGCCCCGG + Exonic
943725352 2:191246175-191246197 CGCAGCGGAGGGGGTTGCCCTGG + Intronic
947518669 2:230828250-230828272 CGCAGCCCCGAGGTGTGCCCGGG + Intergenic
947523357 2:230864841-230864863 CGCAGGCGCGGCGGGCGCCGGGG + Intronic
948190534 2:236054869-236054891 GGCAGCCGGGGAGGGGGCCCGGG - Intronic
948370484 2:237486531-237486553 CGCAGCGGCGCGGAGCTCCCAGG + Intronic
948560756 2:238849462-238849484 CGCAGCCGCGCGGAGCCCCAGGG + Intronic
948824855 2:240569121-240569143 CGCAGCCCCGGCGCCCGCCCCGG - Intronic
949000739 2:241611302-241611324 GGCAGACGCGTGGGGTGCCCTGG - Intronic
949018244 2:241725540-241725562 CGCTCCCGCGTGGGGCGCCTCGG + Exonic
1168804434 20:664177-664199 GGGAGACGCGGGGGGCGCCGGGG - Exonic
1169143492 20:3238662-3238684 CGGCGCCGCGGTGGGAGCCCCGG - Intronic
1170150267 20:13220988-13221010 CGCTGCCGCCGAGGGCGCCCCGG + Intergenic
1170711372 20:18794203-18794225 CGCAGGCCCGCGGGCCGCCCGGG - Intergenic
1172841220 20:37903583-37903605 CGCGCCGGCAGGGGGCGCCCCGG - Intronic
1173166205 20:40688864-40688886 CGCAGCCGCCGCTGCCGCCCGGG + Exonic
1173251507 20:41366375-41366397 CGCACCCGCGGGGGGCGTCGAGG - Intronic
1173633155 20:44531773-44531795 CGCAGCCGCGGAGGGGGCAGAGG - Intronic
1174357781 20:50009958-50009980 CGCGGCCTGGAGGGGCGCCCGGG - Intergenic
1175358646 20:58389625-58389647 CGCTGTCGCGGGGGGCGGCGAGG + Intronic
1175367714 20:58467205-58467227 CGCAGCCCCGGGCGTCGCCCCGG - Exonic
1175367826 20:58467641-58467663 TGCAGCTGCGAGGTGCGCCCAGG - Exonic
1175695445 20:61099774-61099796 CACAGTCGCGGCGGGCACCCAGG + Intergenic
1175987851 20:62772824-62772846 CACTGGCTCGGGGGGCGCCCAGG + Intergenic
1175994197 20:62805066-62805088 CGCAGCCGGGCGGGGGGCGCCGG - Intronic
1176574455 21:8435731-8435753 GGCAGCCGCGGGGATCGCCGAGG + Intergenic
1178417022 21:32412525-32412547 GGCAGCCGCGGGGCGCGCGAAGG + Exonic
1180614766 22:17120221-17120243 CGGCGGCGCGGGGGGCGGCCTGG - Exonic
1181532150 22:23522811-23522833 CCCAGCCGCGGGGCCCGGCCGGG - Intergenic
1182094065 22:27614467-27614489 CGCACCCACGGCGGGCGCCGTGG + Intergenic
1183201173 22:36387011-36387033 AGCAGCCGTCGGGGCCGCCCAGG - Intronic
1184100804 22:42340985-42341007 CGCAGCTCCGCGGGGCTCCCAGG - Intronic
1184342103 22:43891742-43891764 CGTAGATGCGGCGGGCGCCCTGG + Exonic
1184362055 22:44024554-44024576 CGCAGCCGCGTGGGCCGGGCGGG - Intronic
1184594279 22:45504394-45504416 CGCAGCCCCTGGGGGCTCCCTGG + Intronic
1184594591 22:45506142-45506164 CGCAGCCCTTGGGGGCTCCCTGG + Intronic
1185259438 22:49853593-49853615 CGCAGGCGCAGTGGGCGCTCCGG - Intergenic
1185316172 22:50180138-50180160 CTCAGCCGCGGCGGGGGGCCCGG - Exonic
1185374311 22:50475033-50475055 CGCAGGCGCACGGCGCGCCCGGG - Intergenic
1185377350 22:50488540-50488562 GGCAGCCGTGGGGGGGGCCGTGG - Intronic
1185397455 22:50600387-50600409 CGCAGCTCCCGGGGCCGCCCCGG + Intronic
950097619 3:10339081-10339103 TGCAGCCTCAGGGGGCTCCCTGG + Intronic
950829461 3:15859750-15859772 CGCGGCCGCGGGGGCTGCCAGGG - Exonic
951080387 3:18445025-18445047 GGCTCCCGCGGGGGACGCCCCGG - Intronic
953099323 3:39809694-39809716 CGCAGCCGCAGCGGGAACCCGGG - Exonic
953492617 3:43363997-43364019 TGCAGGGGCGGGGGGCTCCCTGG + Intronic
954408681 3:50359528-50359550 CGCTGCCGCCGGGGACGCGCAGG - Exonic
958641503 3:96813415-96813437 CGCGGCGGAGGCGGGCGCCCAGG - Intergenic
961446273 3:126983177-126983199 CGAAGCCGCGTAGGCCGCCCAGG - Intergenic
961482485 3:127193048-127193070 CGCAGCCGCGGGGCGGGGCCTGG - Intergenic
963602993 3:147393333-147393355 CGGAGCTGCAGGAGGCGCCCTGG + Intronic
963605869 3:147411178-147411200 CGCAGCCTCGGTGGGATCCCGGG + Intronic
963904469 3:150762691-150762713 CGCCGCCGCGGCGGGCACCGCGG + Exonic
966860810 3:184230138-184230160 GGCGGCCGCGGGGGGCCCCGGGG + Intronic
966866761 3:184262466-184262488 CGGCGTCGCGGGGGGCGCCCTGG + Intronic
967164983 3:186772571-186772593 CGCTCCCGCCGGGGGCGCTCCGG - Intergenic
967858335 3:194134524-194134546 CGTGACCGCGGCGGGCGCCCAGG + Intergenic
967867734 3:194204148-194204170 GGCAGCCGCGGGGGCGGCGCTGG + Intergenic
968433800 4:575120-575142 CGCAGTCCCCGGGGGCGGCCAGG + Intergenic
968593685 4:1471951-1471973 CGCGGCCGGCGGGGGCGACCCGG + Intergenic
968652906 4:1767151-1767173 CCGAGCCGCGCGGGGAGCCCCGG - Intergenic
969239817 4:5890747-5890769 CGCAGCTGCGGGGCTGGCCCAGG + Intronic
969413284 4:7043248-7043270 GGCCGGCGCGGGGGGCGCGCAGG + Intronic
969619108 4:8270018-8270040 CGGCGCCGCAGGGGGCTCCCGGG - Exonic
972913307 4:43846316-43846338 AGCAGCTGCGGGGGGTGCGCCGG + Intergenic
973867141 4:55125433-55125455 TGCAGCCGCGGTCGGCGCCCGGG - Exonic
978809091 4:112830954-112830976 AGCAGCTGCGGAGGGTGCCCCGG + Intronic
978885389 4:113761583-113761605 CTCAGGCGCGGGGCGCGCCGGGG + Intronic
979033226 4:115678703-115678725 AGCAGCCGCGGAGGGTGCACTGG - Intergenic
981782206 4:148442729-148442751 CGCAGCCGCGGCGGGAGCTTGGG + Intronic
981782628 4:148444765-148444787 CGCCGCCGCTGGGGGCGGGCGGG - Intergenic
983533162 4:168832140-168832162 GGCAGCAGCGGGAGGCGGCCCGG + Intronic
984714962 4:182917174-182917196 CGCGGACGCTGGGGGCGCCTCGG - Intronic
984952652 4:185018657-185018679 AGCAGCCGAGGGGGGCGAGCTGG - Intergenic
987099936 5:14582282-14582304 CAGAGCCGCGCGGGGAGCCCAGG + Intronic
988020517 5:25614768-25614790 AGCAGCTGCGGAGGGTGCCCCGG - Intergenic
990412221 5:55552597-55552619 CGCGGCCCCGGAGGGAGCCCCGG + Intergenic
996329411 5:122312262-122312284 CGCCGGCGCGCCGGGCGCCCCGG + Exonic
996567206 5:124892564-124892586 AGCAGCTGCGGAGGGTGCCCCGG + Intergenic
996567216 5:124892591-124892613 AGCAGCTGCGGAGGGTGCCCCGG + Intergenic
997984483 5:138492018-138492040 CGCAGCCGCGGGCGGGGCGCAGG - Intergenic
998204038 5:140146430-140146452 AGCAGCCGCGGGCGGTGCGCAGG + Intergenic
998583560 5:143403967-143403989 GGCAGCGGCGGGGGCCGACCTGG + Intronic
998583610 5:143404164-143404186 CTCAGCCGCGGGAGGCGCCCCGG - Intronic
998957642 5:147453737-147453759 GGCAGCCGCCGCGGGAGCCCGGG - Intronic
1000463525 5:161548837-161548859 CGCAGCCGCCGCGGGCTCCTCGG - Intronic
1001948027 5:175796740-175796762 CGCGGCCGACGAGGGCGCCCGGG - Exonic
1002580927 5:180209099-180209121 GGCGGCGGCGGGCGGCGCCCCGG - Intronic
1002632480 5:180590904-180590926 CGCCCCCGCGGGAGGCGCCCAGG + Intronic
1003076751 6:2989101-2989123 CGCTGCAGCGGAGGGCGCCTGGG + Intronic
1008932469 6:56954936-56954958 CGCCGCCGCCGCGGCCGCCCGGG + Intergenic
1011099758 6:83708605-83708627 CCCTGCCGCAGGGGCCGCCCGGG + Intronic
1013619260 6:111872824-111872846 GGCAGCCCCGCGGAGCGCCCTGG + Intronic
1016658087 6:146543784-146543806 CGCGGCCGCCGGGGGCGCGGCGG + Exonic
1017497671 6:154995658-154995680 CGCGGCTGCGGGGCGCGGCCTGG + Intronic
1018400234 6:163414342-163414364 CGCCGCCGTGCGGGGCGCCCGGG - Intronic
1018862346 6:167720190-167720212 CGCGGCCCCGGGAGGCGACCAGG - Intergenic
1018968444 6:168507590-168507612 TCCAGCAGTGGGGGGCGCCCCGG - Intronic
1019054451 6:169213442-169213464 TGCAGGGGCGGCGGGCGCCCTGG + Intergenic
1019088331 6:169502239-169502261 CGCGGCCGCGGGAGACACCCAGG + Intronic
1022103810 7:27184608-27184630 CGCCGCCGCGGAGGTCGCCGTGG + Exonic
1022814952 7:33905039-33905061 GGAACCCGCTGGGGGCGCCCGGG - Exonic
1024944199 7:54792540-54792562 CCCAGACGAGGGGGGCGGCCGGG + Intergenic
1025078662 7:55964458-55964480 CGCGGCCGCGGGGGTCGGCGGGG - Intronic
1027668752 7:81071258-81071280 AGCAGCTGCGGAGGGTGCCCCGG + Intergenic
1028268561 7:88759226-88759248 TGCAGCCGCGGGGGGCTCTCGGG - Intergenic
1028621425 7:92833328-92833350 CGCCGCGGCGGGCGGCGTCCAGG - Exonic
1029626327 7:101722366-101722388 CGCAGCCGAGGGGGAGGCCACGG - Intergenic
1029640395 7:101816383-101816405 CGGGGCCCGGGGGGGCGCCCGGG - Intronic
1031401290 7:121328844-121328866 CGGCTCCGCGGGGGGCGCTCCGG - Intronic
1033595317 7:142854899-142854921 GGGAGACGCGGGGCGCGCCCGGG - Intergenic
1034034076 7:147801846-147801868 CCCAGACGGGGGGGGCGGCCGGG + Intronic
1034166488 7:149028658-149028680 CGCAGCCGAGGGCCGCGCGCAGG - Intergenic
1034977736 7:155457978-155458000 CGCCGCCGCCTGGGCCGCCCGGG - Intergenic
1036482630 8:9151634-9151656 CGCAGCCAATGGGCGCGCCCGGG + Intergenic
1036665179 8:10732993-10733015 CGCTGACGCGGGCGCCGCCCGGG + Intronic
1037547813 8:19940377-19940399 CGCAGCCGCGCGGCGGGGCCGGG - Intronic
1037819817 8:22130226-22130248 CGCAGTGGCAGAGGGCGCCCAGG + Intronic
1037915146 8:22768608-22768630 CGCAGCCTCGGGTGGGGCCTCGG + Intronic
1038326661 8:26577403-26577425 CGCAGCCCGGGAGGGCTCCCGGG - Intronic
1038450078 8:27634079-27634101 CACGGCCGCGGGCGGCGCCTAGG + Intronic
1038540495 8:28386322-28386344 CGGAGGCGCGGGGGGCGGGCGGG - Intronic
1041201639 8:55455245-55455267 CGCAGCCGCTGCGGCCGCCGCGG - Intronic
1043463904 8:80486728-80486750 GGGAGCCGCGGGGAGCGCGCGGG + Exonic
1049620835 8:143597735-143597757 CGCAGGCGCGGGGCGGGGCCGGG + Intronic
1049747554 8:144269393-144269415 CGCACCCTCGGGGGGAGACCAGG + Intronic
1051174016 9:14346122-14346144 CGCGGGCGCGGGGGGCGCGTGGG + Intronic
1053149203 9:35732200-35732222 CCCACCCGCGGGCGGCGCCCTGG + Exonic
1053752904 9:41274027-41274049 CGCAGGCGCGGAGGGGGCGCAGG - Intergenic
1054258426 9:62838381-62838403 CGCAGGCGCGGAGGGGGCGCCGG - Intergenic
1054333339 9:63781665-63781687 CGCAGGCGCGGAGGGGGCGCAGG + Intergenic
1054333345 9:63781682-63781704 CGCAGGCGCGGAGGGGGCCCAGG + Intergenic
1055936833 9:81611792-81611814 CGCAGCCGCCGCGGCCGCCGTGG - Exonic
1056773920 9:89497996-89498018 GGCAGCGGCGGGAGGCGGCCGGG + Intronic
1057997148 9:99828723-99828745 CGCAGCCGCCGCGGGCAGCCAGG + Exonic
1061349559 9:130053854-130053876 CGCAGCCGCCGGAAGGGCCCGGG - Exonic
1061762040 9:132857830-132857852 GGGAGCAGCGGGGGGCGCTCAGG - Intronic
1061836357 9:133332563-133332585 CGGAGCCGCGGGAGCCGCCCGGG - Exonic
1062375499 9:136260090-136260112 AGCAGCCGCGGCGACCGCCCAGG - Intergenic
1062388219 9:136323376-136323398 CGCAGACCCGGGGGGAGACCTGG + Intergenic
1062395667 9:136351674-136351696 CGCAGCAGGTGGGGGCTCCCTGG - Intronic
1062459983 9:136658987-136659009 CTGAGCCTCGGGGGTCGCCCGGG - Exonic
1062501346 9:136853307-136853329 CACAGGCGAAGGGGGCGCCCAGG - Exonic
1062634719 9:137484799-137484821 TGCAGCCTCGGGGGGCCCCAGGG - Intronic
1202800344 9_KI270719v1_random:169989-170011 CGCAGGCGCGGAGGGGGCGCAGG + Intergenic
1203731932 Un_GL000216v2:98959-98981 CGGGGCCGCGGGGGCCGCCAGGG + Intergenic
1203468906 Un_GL000220v1:107933-107955 GGCAGCCGCGGGGATCGCCGAGG + Intergenic
1203476727 Un_GL000220v1:151905-151927 GGCAGCCGCGGGGATCGCCGAGG + Intergenic
1203654208 Un_KI270752v1:7781-7803 CGCCGCCTCGGGGGACGCCGCGG - Intergenic
1185877629 X:3713320-3713342 CGCAGCCTCGGAGGGCGGCGCGG + Exonic
1187507129 X:19887215-19887237 CGGAGCCCGGGAGGGCGCCCCGG - Intronic
1189275909 X:39785977-39785999 CCCAGCCCCTGGGGGCTCCCCGG - Intergenic
1192962546 X:76145496-76145518 GGCAGCCGGTGGGGGTGCCCCGG - Intergenic
1192962987 X:76149591-76149613 GGCAGCCGGTGGGGGTGCCCCGG + Intergenic
1199500503 X:148501229-148501251 AGCTGTCGTGGGGGGCGCCCCGG + Intronic
1199942222 X:152637932-152637954 CGCAGCTGCCGGGCGGGCCCTGG + Intergenic
1200151273 X:153952562-153952584 CGCAGCCACGGAGGAAGCCCAGG - Exonic
1200787678 Y:7274224-7274246 CGCAGCCTCGGAGGGCGGCGCGG - Intergenic