ID: 901614951

View in Genome Browser
Species Human (GRCh38)
Location 1:10531357-10531379
Sequence GCAGCATTTCTGTTTGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 220}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901614948_901614951 26 Left 901614948 1:10531308-10531330 CCATATTTGTCAAGGAACTCCTG 0: 1
1: 0
2: 1
3: 8
4: 122
Right 901614951 1:10531357-10531379 GCAGCATTTCTGTTTGAAGAGGG 0: 1
1: 0
2: 0
3: 16
4: 220
901614949_901614951 7 Left 901614949 1:10531327-10531349 CCTGACAGAGTACTGATTTCTTA 0: 1
1: 0
2: 1
3: 16
4: 145
Right 901614951 1:10531357-10531379 GCAGCATTTCTGTTTGAAGAGGG 0: 1
1: 0
2: 0
3: 16
4: 220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901614951 Original CRISPR GCAGCATTTCTGTTTGAAGA GGG Intronic
901614951 1:10531357-10531379 GCAGCATTTCTGTTTGAAGAGGG + Intronic
902520378 1:17012215-17012237 GCAGCAGTTCTCTGTGAAGCAGG - Intergenic
903087032 1:20870748-20870770 TCAGCATTTCTTTTTGGAGGAGG - Intronic
903110719 1:21130577-21130599 GTAGCATTTATGTTTGGAAATGG - Intronic
903250321 1:22048617-22048639 GCAGCATCTCTGCTTGCAGTGGG + Intergenic
904629951 1:31833596-31833618 CCTGCATGTCTGCTTGAAGAAGG - Intergenic
907814797 1:57908136-57908158 GGAGCAATTCTGTTAAAAGAAGG - Intronic
910199299 1:84682023-84682045 AGAGCATTTGTTTTTGAAGAGGG - Intronic
910328981 1:86047047-86047069 GCAGAATTTTGTTTTGAAGAAGG - Intronic
913225825 1:116697292-116697314 CCAGCATTTCTGTCTGCAGAAGG + Intronic
914423641 1:147553671-147553693 GCAGCATTTCTTTTCCAAAAGGG - Intronic
917063483 1:171066355-171066377 GCTACACTTCTTTTTGAAGATGG + Intergenic
917752022 1:178062241-178062263 CCAGCCTTTCTTTGTGAAGACGG + Intergenic
919504314 1:198378903-198378925 GGAGCTTTTATGTTTGAATAAGG - Intergenic
920356754 1:205379038-205379060 GCAGCCTCTGTGTTAGAAGAGGG - Intergenic
920412764 1:205775040-205775062 GCCTCACTTCAGTTTGAAGAGGG - Exonic
1067257601 10:44659512-44659534 GCAGCATTTGTGATAGTAGAAGG - Intergenic
1067880416 10:50039225-50039247 GAAGCAGTTCTTTTTAAAGATGG + Intergenic
1068129777 10:52883264-52883286 GCAGCACTTCAGATGGAAGATGG + Intergenic
1070259407 10:74840043-74840065 GCAGCATTTCAATTTGCAGAAGG + Intronic
1071114666 10:82203831-82203853 ACAGAATTTCTGTTGGCAGATGG - Intronic
1071924200 10:90386862-90386884 GTATAATTTCTGTTTGAAGGGGG + Intergenic
1072368152 10:94735428-94735450 GCTTCATTCCTGTCTGAAGAAGG + Exonic
1073775503 10:106781147-106781169 GCAGCATTCCTCTGGGAAGAAGG - Intronic
1073956354 10:108875903-108875925 GCAGCTCTGCTGTTTTAAGATGG + Intergenic
1074456251 10:113597906-113597928 CTAGCATTTCCTTTTGAAGAGGG - Intronic
1074902279 10:117828922-117828944 ACATCATTCCTGTTTGAACATGG - Intergenic
1075905443 10:126077652-126077674 GCAGCATTTATTATTGAATAGGG - Intronic
1076420013 10:130324644-130324666 GCAGAATTTCTGTTTGCACTAGG - Intergenic
1076909618 10:133380374-133380396 ACAGCATTCCAGGTTGAAGAAGG - Exonic
1078078009 11:8178995-8179017 GGAGTAGGTCTGTTTGAAGAAGG + Intergenic
1080040839 11:27757870-27757892 GCAGAACTTCTGATTAAAGAAGG - Intergenic
1080471865 11:32553560-32553582 GTATCACTTCTGTTTGAAAATGG - Intergenic
1083040833 11:59684755-59684777 GTAGCATTTCTGTATGGTGATGG + Intergenic
1083205666 11:61147310-61147332 GCAGCATTTCTGGGTGCAGCCGG + Intronic
1086722050 11:90133349-90133371 GAAGCATTTCTCTTTAAAGATGG - Intronic
1087342521 11:96925737-96925759 GCAGAATTCCTCTTTGAACATGG + Intergenic
1089807056 11:121099775-121099797 GCAGCAGTCCTGTCTCAAGAAGG + Intergenic
1090060607 11:123461345-123461367 CCAGCATTTCTGTCTGCAGCTGG + Intergenic
1090206928 11:124890057-124890079 GTAGCATTACTGTTCTAAGAGGG + Intronic
1095664492 12:44780490-44780512 GCCTCATTTCTGCTTGAACAGGG - Intronic
1097957287 12:65499234-65499256 GTAGCATTTCTGATGGCAGAAGG + Intergenic
1098293500 12:68981082-68981104 GAAGCATTTCTGTTGGTGGAGGG - Intergenic
1099609058 12:84842917-84842939 TGAGCATTTATGTTTGAAGGTGG + Intergenic
1099638643 12:85253141-85253163 GCAGCATTAATGTTTAAAGTTGG + Intronic
1099881386 12:88471024-88471046 GCAGGATTTGTGCTCGAAGAGGG - Intergenic
1100014118 12:89988091-89988113 CCAGCATTTAGGTTTGAATATGG + Intergenic
1102191316 12:110990802-110990824 GCATTATTTTTGTTTGCAGAGGG + Intergenic
1103125273 12:118416714-118416736 GCAGCCTTCCTGTTAGTAGATGG + Exonic
1105383995 13:19913382-19913404 GCACCATTTCCATTTGATGATGG - Intergenic
1106035272 13:26038516-26038538 GGAGCATTTGTCTTTGAAGGGGG + Intergenic
1106068400 13:26381217-26381239 GCAGCATTTCTATTTGCTAAAGG - Intronic
1108913860 13:55584714-55584736 GCAATAATTTTGTTTGAAGAAGG + Intergenic
1109255156 13:60071384-60071406 GAAGCTATTCTGTTTGAAAAAGG - Intronic
1109359544 13:61278193-61278215 GCAATACTTCTGTTTGCAGAAGG + Intergenic
1109853437 13:68099259-68099281 GGAACATTTGTGTTTAAAGAGGG - Intergenic
1111425730 13:88078806-88078828 TCAGCATCTCTGTTTCAAGGGGG + Intergenic
1111942437 13:94624836-94624858 CCAGCCTTTCTTTTTTAAGATGG + Intronic
1111960774 13:94807689-94807711 GCAATGTTGCTGTTTGAAGATGG - Intergenic
1112205480 13:97319740-97319762 CCAACATTTCTCTTTGAAAATGG + Intronic
1112610851 13:100953248-100953270 GCTGAATATCTGTTTGAAAAAGG + Intergenic
1112625789 13:101102014-101102036 GCTGAATTTCTTTTTTAAGATGG - Intronic
1113004874 13:105688977-105688999 CCAGCATTTCAGTGTGAAGGAGG - Intergenic
1113579391 13:111418379-111418401 GCTGCATTTCTGGTGGGAGATGG - Intergenic
1115096546 14:29644209-29644231 ACAGGATTTCAGTTTTAAGATGG + Intronic
1117431443 14:55667752-55667774 GTAAGATTTCTGCTTGAAGAAGG - Intronic
1117501421 14:56356567-56356589 GCAGGATTTCTGTTGGGAGATGG + Intergenic
1117752679 14:58939718-58939740 GCAGCATCTCTGTTGGTGGATGG + Intergenic
1120704007 14:87728797-87728819 GCAGCAGTTATCTTTGAGGAGGG - Intergenic
1120754735 14:88231838-88231860 AAAGCACTTCTTTTTGAAGAAGG - Intronic
1127297337 15:57620375-57620397 CCAGAATTTCTGTTTTAGGAAGG - Intronic
1128169751 15:65500652-65500674 GGAACATTTCTGTTTCAAGCCGG - Exonic
1128644198 15:69362944-69362966 TCTTGATTTCTGTTTGAAGAAGG + Intronic
1129915164 15:79263485-79263507 GCAGTATTTCTGTATCAATAAGG - Intergenic
1130391222 15:83457089-83457111 ACAGCATTTATTGTTGAAGAAGG + Intronic
1130695287 15:86125013-86125035 GCAGCATCTCTGATTCATGAGGG + Intergenic
1131618672 15:94043687-94043709 GGAGCATTTTTTTTTAAAGATGG + Intergenic
1132064425 15:98718822-98718844 GCAGCCTTACTGTTTGAATTAGG + Intronic
1132537875 16:492337-492359 GCAGAAGTGCTCTTTGAAGAGGG + Intronic
1134384930 16:13763136-13763158 GCAGGATTTTTTTTTTAAGACGG + Intergenic
1138786709 16:59855003-59855025 GCAGCATTTCTAAAAGAAGATGG - Intergenic
1144023148 17:11254760-11254782 GCAAAACATCTGTTTGAAGATGG + Intronic
1146737058 17:35247469-35247491 GCAGCCATCCTGTTTGAAAATGG - Intronic
1146761069 17:35479315-35479337 GCATCACTTCTGTGTGGAGAAGG - Exonic
1148510599 17:48165804-48165826 GCACCATTTCTGATTTCAGACGG - Intronic
1148860453 17:50601786-50601808 GCAGCAATTCTGGTTCCAGAAGG + Intronic
1150157627 17:62867554-62867576 GCAGCATTTCTCATTGAATTTGG + Intergenic
1150183359 17:63151695-63151717 TCAACATTTCTGTTTGCACATGG - Intronic
1150497656 17:65620955-65620977 GTAACATTTCTCTTTCAAGATGG + Intronic
1150862801 17:68818537-68818559 GTAGCTTTTCAGTTTTAAGATGG - Intergenic
1151462592 17:74263429-74263451 GCAGTATTTATTTTTAAAGATGG - Intergenic
1152264662 17:79287341-79287363 GCAGCATGTCTGTGCAAAGAGGG + Intronic
1153485978 18:5598207-5598229 GCAACATTTCTGAGTGAAGTTGG + Intronic
1155320568 18:24614814-24614836 AAAGCATTCATGTTTGAAGAAGG + Intergenic
1155579957 18:27292890-27292912 GCTGCATTTTTGCTTGAAGTAGG + Intergenic
1156511927 18:37644205-37644227 GCAGCATCTCTGTGTGTATAAGG - Intergenic
1159669590 18:71206483-71206505 GCAGCATTTCTGAATGAAATTGG + Intergenic
1161751845 19:6103703-6103725 GAAGCACTTATGTTTGCAGAGGG + Intronic
1163823000 19:19506926-19506948 GTAGCAGTTGTGTTTGAAGGCGG - Exonic
1164583668 19:29451543-29451565 GCAGTGTTTGTTTTTGAAGATGG - Intergenic
1164895997 19:31878271-31878293 GCATCATTTCTATTTGAATCTGG - Intergenic
1165099694 19:33431620-33431642 GCAGCACCTCTGCCTGAAGATGG + Intronic
925208951 2:2031333-2031355 GCAGCTTTGCTGTTTGACCATGG - Intronic
927086100 2:19675270-19675292 CCTGCATCTCTGTTTGGAGAAGG - Intergenic
927479689 2:23442478-23442500 GCAGAGTTTGTCTTTGAAGATGG + Intronic
927703531 2:25283058-25283080 GGAGCATTTCTTTTTTAACAGGG - Intronic
928422623 2:31150766-31150788 TCAGCATTTTTTTTTCAAGACGG + Intronic
931021463 2:58048813-58048835 GCATCACTTCTGTTGGCAGAAGG - Exonic
931070148 2:58637876-58637898 GAAGGATTTCTTTTTGAAGACGG + Intergenic
931929043 2:67108294-67108316 ACAGCATTTCTGTTAGAAGTGGG + Intergenic
934808311 2:97258304-97258326 ACAGCATTTTTTTTTCAAGATGG + Intronic
934829198 2:97498882-97498904 ACAGCATTTTTTTTTCAAGATGG - Intronic
935335868 2:102015857-102015879 GAAGCATTTCTGATTTAAAAGGG - Exonic
935960621 2:108422345-108422367 ACAGCCATTCTGTTTCAAGATGG - Intergenic
937777726 2:125799731-125799753 GCAGCATTTCATTTTTAAAAGGG + Intergenic
938146506 2:128839021-128839043 TCAGGATCTCTGATTGAAGAGGG - Intergenic
938313419 2:130309913-130309935 GCAGCATGTCACATTGAAGAGGG - Intergenic
939150739 2:138469538-138469560 ACAGCCTGGCTGTTTGAAGACGG + Intergenic
941012133 2:160312208-160312230 GCATCATTACTTTTGGAAGAGGG + Intronic
941193668 2:162419386-162419408 GGAGCTTTTCTGCTTGAGGATGG - Intronic
942150636 2:173073151-173073173 TCAGAATATCTATTTGAAGAGGG + Intergenic
942151862 2:173083920-173083942 GCAACCTTACTTTTTGAAGAAGG + Intronic
942429032 2:175890000-175890022 TCATCATTTTTGTTTGAAGGAGG + Intergenic
943222418 2:185127388-185127410 GCATAAATTTTGTTTGAAGAGGG - Intergenic
944989312 2:205217510-205217532 CTAGCTTCTCTGTTTGAAGATGG - Intronic
947656904 2:231835293-231835315 GCACTATTTCTGTTTGGAGCAGG - Intergenic
948509757 2:238455952-238455974 GCAGCATGACTGCCTGAAGAGGG + Intergenic
1170012362 20:11738307-11738329 GCAGCATTTTATTTTGAACATGG + Intergenic
1170048903 20:12118573-12118595 AAAGTATCTCTGTTTGAAGATGG + Intergenic
1170506943 20:17036443-17036465 AAAGCATTCCTGTTTGATGATGG - Intergenic
1171080957 20:22184058-22184080 GTAACATATCTGTTTGAGGAAGG + Intergenic
1171227662 20:23454852-23454874 GCTGCATTTTTGTTTGAGTATGG + Intergenic
1173146186 20:40526509-40526531 GCATCATTTGAGGTTGAAGAGGG - Intergenic
1174069114 20:47887654-47887676 GCAGCATTTCTGTTGGACTCAGG + Intergenic
1179174859 21:39000949-39000971 CCAGCATTTCTGATTCAGGAGGG + Intergenic
1180138739 21:45878050-45878072 TCCGCATTTCTGTCTGAGGATGG + Intronic
1182684830 22:32113957-32113979 GCAGCACCTCTTTTAGAAGATGG + Intergenic
951878588 3:27457459-27457481 GCAGAATATCTGTGTGAATATGG - Intronic
952086896 3:29833571-29833593 AGATCATTTCTGTTTGATGAAGG - Intronic
952443591 3:33358207-33358229 GCAGCTTTTCTGTGAGAAGAAGG - Intronic
952475962 3:33710927-33710949 GCAGAATTTCTTTTTTGAGATGG - Intronic
952974167 3:38680029-38680051 GCAGCTTTTCTGGTCCAAGATGG + Intergenic
954816594 3:53286915-53286937 GCAGCATTACCATTTGAATAGGG - Exonic
954976661 3:54702015-54702037 GCACCATTTATTTTTGAATAGGG - Intronic
956344934 3:68268284-68268306 GCACCATTTCAGTTTAAAGGAGG + Intronic
957563227 3:81852307-81852329 GCATTATTTCTGTTTTGAGATGG + Intergenic
958457549 3:94350400-94350422 GTATCATTGCTGTTTAAAGAAGG - Intergenic
958510482 3:95040573-95040595 GCAGCATATATGCATGAAGAAGG - Intergenic
959126668 3:102298051-102298073 TCAGCAATTCTGTTTGCAGGCGG - Intronic
959136301 3:102426191-102426213 GCAGTATTTCTGTTTTGAAATGG - Intronic
962964628 3:140342088-140342110 GTAGCATTCCTTTGTGAAGATGG + Intronic
963281272 3:143386787-143386809 ACATTATTTCTGTTTAAAGAGGG + Intronic
963526282 3:146418508-146418530 GAGGCATTTCTGTTCAAAGAGGG + Intronic
964442459 3:156726387-156726409 GCAGCATTTCAGATGGAAGTGGG - Intergenic
964709552 3:159657204-159657226 GCACCATCTCTGTTGGAAGATGG - Intronic
966017885 3:175165616-175165638 ACAGAAATTCTTTTTGAAGAGGG - Intronic
966607245 3:181833865-181833887 GCTGTATTTCTGTGTCAAGATGG - Intergenic
967669055 3:192210618-192210640 GCAGCACTTCTGTTTGACCTCGG + Intronic
968588757 4:1447154-1447176 GAAGAAATTCTGTCTGAAGATGG + Intergenic
969484939 4:7466933-7466955 GCTGCCTTTCTCTTTGGAGATGG + Intronic
971929777 4:33065764-33065786 GCAGAATATCTTTTTGAAGAGGG + Intergenic
972132064 4:35850073-35850095 GGAGCATTTTTATTTTAAGATGG - Intergenic
973219721 4:47711430-47711452 GCAGCACGTCTCTTTGAAGGAGG - Intronic
975837370 4:78438821-78438843 GCAGCATCTTTGTTTAAAAATGG - Intronic
979708974 4:123755253-123755275 TCAGAATTTCTGAATGAAGATGG - Intergenic
980184349 4:129443168-129443190 TCAGCATTTCACTTTCAAGAGGG - Intergenic
982058389 4:151576777-151576799 GCTGCATGTTTGGTTGAAGAGGG + Intronic
984238473 4:177190316-177190338 GCAACATCTATGTGTGAAGATGG + Intergenic
987182829 5:15385309-15385331 TCAGCATTGCTGTCTGCAGACGG + Intergenic
989255808 5:39364713-39364735 GCAGCAGTGCTGTGTGAAAATGG + Intronic
989334879 5:40304414-40304436 TCATTATTTCTGTTTAAAGAAGG - Intergenic
990422000 5:55645063-55645085 GCCGCATTTATTTTTTAAGATGG + Intronic
990521659 5:56587112-56587134 GCTGCATTTGTGTTTGTTGATGG - Intronic
990664374 5:58055120-58055142 GCAATTTCTCTGTTTGAAGAAGG - Intergenic
990925817 5:61021337-61021359 GCGACAGATCTGTTTGAAGATGG - Intronic
992546844 5:77821660-77821682 GCAGGGTTTCTGTTTGAAAGAGG + Intronic
992586935 5:78250537-78250559 CCAGAATTTCTGTTTGAAATTGG - Intronic
992968138 5:82024887-82024909 GCAGGATTTATGTCTGAAGGAGG + Intronic
994581515 5:101648513-101648535 TCAGCATTTCTATTAGAACAGGG - Intergenic
996523396 5:124451528-124451550 GCTGCATTTCTGTTTGGTCAAGG - Intergenic
999482405 5:151960875-151960897 TCATCATTTGTGTTGGAAGAAGG + Intergenic
999875899 5:155805415-155805437 GCAGCATTTCTGGTAGGAAAAGG + Intergenic
1003237311 6:4307406-4307428 ACAGAATTTCTGTTTAAAGAAGG + Intergenic
1003793698 6:9576411-9576433 GCTAAATTTCTGTTAGAAGAGGG + Intergenic
1007247845 6:40475232-40475254 GCAGCGGTTCTGCTTGGAGATGG + Intronic
1007487272 6:42189735-42189757 GCCGCATTTCTGTTACAAGAAGG - Intronic
1010846089 6:80710139-80710161 GCACCATTTATGTTTTCAGAAGG + Intergenic
1013713691 6:112932222-112932244 GCAGCATTTATTTTAGAAGTAGG - Intergenic
1014384520 6:120784646-120784668 GAAACATTTTGGTTTGAAGATGG - Intergenic
1015339097 6:132077085-132077107 GCATTTTTTCTGTTTGAATATGG + Intergenic
1018585769 6:165356445-165356467 TCAGTATTTATGTTTGACGAAGG - Intronic
1018760798 6:166892854-166892876 GCGGCTTTTCTGTTAGAAAAAGG + Intronic
1021580944 7:22152699-22152721 TCACCATTTCTTTTTGAAGTAGG + Intronic
1021957961 7:25845241-25845263 GCAGCTATTCTGCTTGCAGAGGG - Intergenic
1022120743 7:27305749-27305771 GCAGCATGTCAGAATGAAGAGGG + Intergenic
1027543189 7:79493755-79493777 GCAGATTTACTGTTTGAGGAGGG - Intergenic
1028425412 7:90681861-90681883 GAAGAATTTTTCTTTGAAGATGG - Intronic
1028552079 7:92079720-92079742 GAAGCATTTCTGTTTCAAACTGG - Exonic
1028667207 7:93360359-93360381 CCACCATTTCATTTTGAAGATGG - Intronic
1030700645 7:112635930-112635952 GCATCATTTCTCTTTGAACTGGG + Intergenic
1030738900 7:113085288-113085310 GCAGCTTCTCTGTTTGATGTGGG + Intronic
1032992415 7:137408571-137408593 GCTGCATATCTGGATGAAGAAGG - Intronic
1033424467 7:141231571-141231593 GCAGCATTCCTATTTAGAGACGG + Intronic
1035467569 7:159089811-159089833 GCAGCATTTCTGTGAGAACAAGG + Intronic
1035989431 8:4471702-4471724 GCTGCATTTTTCTTTGAAGATGG - Intronic
1037637965 8:20717520-20717542 GCTGCATTTGTGTGTGAAGGAGG + Intergenic
1037712345 8:21364864-21364886 GCAGCAGTTCTGTTTTTGGAAGG - Intergenic
1039007046 8:33050966-33050988 GCAGGAATTCTGTTTGAATCTGG - Intergenic
1042811796 8:72833751-72833773 GGAGCATTTCTAAATGAAGAAGG + Intronic
1043183954 8:77121190-77121212 GCAGGCTTTCTTTTTGTAGATGG + Intergenic
1043273080 8:78358172-78358194 GCAGAAATTCTGTTTTAAGAAGG + Intergenic
1043388871 8:79771746-79771768 GCAGCATTTCTCTATGAACGAGG + Intergenic
1044530828 8:93305615-93305637 TGATCATTTCTGTGTGAAGAAGG - Intergenic
1044617186 8:94154686-94154708 GCAGCTTGTCAGTTTGAGGATGG - Intronic
1044790473 8:95841691-95841713 GCCCCATTTGTCTTTGAAGAAGG - Intergenic
1045257375 8:100538618-100538640 CCTGTAATTCTGTTTGAAGAGGG - Intronic
1045855930 8:106765505-106765527 GCAGCATTTCTCCTAGAAGTTGG - Intronic
1046705403 8:117444449-117444471 ACAGCTTTTGTGTTTGGAGAAGG + Intergenic
1046860873 8:119090085-119090107 GCAGCATTTTTTTTTTAAGCTGG + Intronic
1047014734 8:120711714-120711736 GCAGGATTTCTGATTCAAGCAGG + Intronic
1047108987 8:121767536-121767558 AGAGCATTTCTGTTAGAAGATGG - Intergenic
1048637717 8:136316522-136316544 GCAACATTTCCTTTTTAAGAAGG + Intergenic
1049977296 9:871797-871819 GCTGCATTTCTTTTGGAAGATGG + Intronic
1050017268 9:1247276-1247298 GCAGCAGCTCTTTTTGCAGAAGG + Intergenic
1050233232 9:3551063-3551085 ACAGCATTTATATTAGAAGAAGG + Intergenic
1050237152 9:3594091-3594113 TCAGCATTTCTGTCTTACGACGG - Intergenic
1051563704 9:18472051-18472073 GCAGGGTTTATGTGTGAAGAGGG + Intergenic
1051638683 9:19204364-19204386 CCAGCATTTTTTTTTAAAGAGGG + Intergenic
1055392693 9:75840189-75840211 GCAGCCTTGCTCTCTGAAGATGG - Intergenic
1056459251 9:86793301-86793323 GCATCTTTTCTATTTGAAAAGGG - Intergenic
1058292390 9:103258184-103258206 TCAGCATTTCTCTTTGAGTAGGG + Intergenic
1195095315 X:101496081-101496103 CCAGCATTTCTCTCTGGAGAAGG - Intronic
1195895050 X:109737468-109737490 ACAGAATTTTGGTTTGAAGAGGG - Intergenic
1195905698 X:109842126-109842148 GCAGCTTTTGATTTTGAAGATGG - Intergenic
1197782885 X:130174447-130174469 CCAGCATGTCTGTGGGAAGATGG + Intronic
1198534133 X:137569762-137569784 GCAGCATTTTTCTTTTAAGTGGG + Intronic
1200106852 X:153718971-153718993 CTAACACTTCTGTTTGAAGAAGG + Intronic