ID: 901623946

View in Genome Browser
Species Human (GRCh38)
Location 1:10612823-10612845
Sequence TGGCTTCTGAGCGAAGCTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 165}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901623940_901623946 25 Left 901623940 1:10612775-10612797 CCAGGACCTTACTGGGAGTGAGC 0: 1
1: 0
2: 1
3: 8
4: 93
Right 901623946 1:10612823-10612845 TGGCTTCTGAGCGAAGCTGATGG 0: 1
1: 0
2: 1
3: 8
4: 165
901623942_901623946 3 Left 901623942 1:10612797-10612819 CCTGTCTTGTCATTTAATTTTCA 0: 1
1: 0
2: 3
3: 45
4: 513
Right 901623946 1:10612823-10612845 TGGCTTCTGAGCGAAGCTGATGG 0: 1
1: 0
2: 1
3: 8
4: 165
901623941_901623946 19 Left 901623941 1:10612781-10612803 CCTTACTGGGAGTGAGCCTGTCT 0: 1
1: 0
2: 0
3: 15
4: 148
Right 901623946 1:10612823-10612845 TGGCTTCTGAGCGAAGCTGATGG 0: 1
1: 0
2: 1
3: 8
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901623946 Original CRISPR TGGCTTCTGAGCGAAGCTGA TGG Intronic
900356361 1:2266707-2266729 TGGCTGATGAGAGAAGCTGGAGG - Intronic
901623946 1:10612823-10612845 TGGCTTCTGAGCGAAGCTGATGG + Intronic
901709754 1:11104499-11104521 TGGCTTCTCTGGGAGGCTGAGGG + Intergenic
901776849 1:11565994-11566016 TGGCTTCTTATGGAGGCTGAGGG - Intergenic
902736687 1:18405889-18405911 GGGCTGCTGAGCTGAGCTGATGG + Intergenic
906189498 1:43887153-43887175 TAGCTGCTGAGCAAAGTTGAGGG + Intronic
909823923 1:80101395-80101417 TGGCTGCTGAGCACTGCTGAAGG + Intergenic
910464879 1:87488104-87488126 TGGCTTCTGGGTGAGGATGAGGG - Intergenic
914855125 1:151345122-151345144 TGGGTCCTGAGGGGAGCTGAAGG + Exonic
915331579 1:155116190-155116212 TGGCTTCAGAAGCAAGCTGAGGG - Intergenic
919747345 1:201017079-201017101 TGGCTTCTGAGTAACGCTAAGGG + Intronic
919775673 1:201192560-201192582 TGGCTTCTGAGGGGAGCAGATGG + Intronic
920304331 1:205009023-205009045 TGGCTTCAGAGCCATGCTGGTGG + Intronic
920431272 1:205920838-205920860 TGGCTTCAGACAGAAGCTGCAGG + Intronic
920555626 1:206902178-206902200 GGGCTTTGGAGCAAAGCTGATGG - Intronic
920932269 1:210400227-210400249 TTGCTTCTGGGTGGAGCTGATGG + Intronic
920941536 1:210487933-210487955 GGGCTTCTGAGGGATGGTGAAGG - Intronic
923135685 1:231116553-231116575 TGGCTTCTGAGAGGAGCAGGAGG - Intergenic
923658580 1:235939501-235939523 TGGCTTCTGAGAGATACTCATGG + Intergenic
924445428 1:244125669-244125691 TGGAAACTGAGTGAAGCTGAAGG + Intergenic
924860934 1:247921456-247921478 TGGCTCCTGGGTGCAGCTGACGG + Exonic
924874263 1:248084135-248084157 TGGCTCCTGGGTGCAGCTGACGG - Intronic
924890493 1:248273354-248273376 TGGCTCCTGGGTGCAGCTGACGG - Exonic
924892144 1:248295118-248295140 TGGCTCCTGGGTGCAGCTGACGG - Exonic
1065154043 10:22851630-22851652 TGGCTTCTGAGTGGAGGAGAAGG + Intergenic
1065917487 10:30365495-30365517 TGGCTTATGTGGGCAGCTGAGGG - Intronic
1067789916 10:49280040-49280062 TGCCTTCTAAGAGAAGCTCAGGG + Intergenic
1070261818 10:74863817-74863839 TGGCTTCTTAGGGAAGTTGGAGG + Intronic
1074224021 10:111466198-111466220 TGGGTTCTTAGTGGAGCTGAGGG + Intergenic
1074966504 10:118495417-118495439 TTGCTTCTGATCAAAGGTGATGG + Intergenic
1076669576 10:132112117-132112139 TGGCATCTGGGCGAGGATGATGG + Intronic
1078438041 11:11341523-11341545 TGGGTTCTGACTGAATCTGAGGG + Intronic
1083243954 11:61411119-61411141 GGCCTTCTGAGTGAGGCTGAAGG - Intronic
1083272437 11:61579218-61579240 TGGCTTCTGAACTAAGCTACTGG + Intronic
1083366332 11:62143692-62143714 TGGCTTCTGAGCCTAACTGGAGG - Intronic
1084088520 11:66865736-66865758 TGGAGTCTGAGCCAAGCTCAGGG - Intronic
1084267054 11:68010494-68010516 TGGCCTCTGAGTGCAGCTGCCGG - Intronic
1090347930 11:126085839-126085861 TGGCTTCTGAGCTTCCCTGAAGG + Intergenic
1091857888 12:3753632-3753654 TGCCTTGTGCGCTAAGCTGAGGG - Intronic
1092081996 12:5723971-5723993 TGGGTTCTGTCCCAAGCTGAAGG - Intronic
1096458052 12:51803640-51803662 GGGCTTCAGAGAGAAGATGATGG - Intronic
1102660013 12:114518212-114518234 TCTCTTCTGAGAGATGCTGAAGG - Intergenic
1106027192 13:25966776-25966798 TGGATTCTGACCTAAGCTGTAGG + Intronic
1107065977 13:36214616-36214638 TGGCTCCTGGCCGCAGCTGAGGG + Intronic
1107728285 13:43321989-43322011 TAGCTTCTGAGCCAAGATGCTGG - Intronic
1107869876 13:44736529-44736551 TGGCCTCTGAGCCATGGTGAAGG - Intergenic
1108069476 13:46613496-46613518 TGAGTCCTGAGCAAAGCTGAGGG - Intronic
1109252127 13:60032158-60032180 TGGCATCTGAGAGCAGCTGTGGG - Intronic
1112254550 13:97817749-97817771 TGTGTTCTCAGCAAAGCTGATGG + Intergenic
1113859825 13:113474140-113474162 TGGGTTCTTAGCGAAGGTGAAGG + Exonic
1114449999 14:22819170-22819192 TGGCTCCTCAGCCAAGCTCAGGG + Intronic
1116266926 14:42704132-42704154 TGGCATATGAGCAAAGGTGAGGG + Intergenic
1116469293 14:45268710-45268732 TGGCATCAGAGCTAAGCTGCAGG - Intergenic
1118837856 14:69489239-69489261 TTGCTTCTGAGAGCAGCTGTGGG + Intronic
1118859493 14:69651417-69651439 TGGCTTAAGAGGAAAGCTGAGGG + Intronic
1121201412 14:92121501-92121523 GGGCTTCCGAACGAAGGTGACGG - Intronic
1121349297 14:93160791-93160813 TGGCTTCTGCTGGAATCTGATGG - Intergenic
1122817253 14:104319804-104319826 TGGCTTCTGTGGGGAGCTCAGGG + Intergenic
1124341816 15:28894680-28894702 TGGGTTGGGAGCGAAGCAGATGG + Intronic
1127408483 15:58680086-58680108 TGGCTTCTGCGCTATGCTTAGGG + Intronic
1128737173 15:70059759-70059781 TGGCTTCAGAGAGAAGCAGAAGG - Intronic
1129312625 15:74723121-74723143 TGGCTGCTGAGAGAAGGTGCAGG + Exonic
1129390365 15:75217265-75217287 TGACTTCCCAGCCAAGCTGATGG - Intergenic
1131829204 15:96343712-96343734 GGGCTTCTAGGCGAAGCTAATGG + Intergenic
1132854636 16:2039276-2039298 TGGCTTCACAGGGAAGGTGAAGG - Intergenic
1136241246 16:28945644-28945666 TGGCTACAGAGAGAGGCTGAAGG + Intergenic
1137560493 16:49499160-49499182 TGGCCTCAGAGTGAAGCTGGTGG + Intronic
1138220784 16:55248613-55248635 TGGCCTCTGAGAGCTGCTGAAGG - Intergenic
1140187548 16:72788359-72788381 TGGCTTGTGAGCAATGCTGTGGG + Exonic
1142230741 16:88899182-88899204 TGGCCTCTGAGCCAAGCTGATGG - Intronic
1148572092 17:48678378-48678400 TGGCTTTTGACCAGAGCTGAGGG - Intergenic
1149780167 17:59391201-59391223 TGGCTTCTGAAGGAGCCTGAAGG + Intronic
1151419583 17:73988367-73988389 TGGACTCTGAGCAAAGCAGATGG - Intergenic
1152130579 17:78473895-78473917 TGGGTTCTCAGCGCATCTGATGG - Intronic
1152934200 17:83126501-83126523 TGGTCTCTGAGACAAGCTGATGG + Intergenic
1157149754 18:45204986-45205008 GGTGTTCTGAGCAAAGCTGAGGG - Intergenic
1158679093 18:59550454-59550476 AGGCTTCTGAGTGCAGATGAAGG - Intronic
1158743396 18:60168789-60168811 TGAGTGGTGAGCGAAGCTGAAGG - Intergenic
1159366202 18:67468751-67468773 TTGCTTAGGATCGAAGCTGATGG - Intergenic
1161492620 19:4570539-4570561 TGGCGGTTGAGCGAAGATGAGGG - Intergenic
1162507736 19:11096754-11096776 TGGCTTCTGAGCCTAGTTCATGG - Intronic
1163622557 19:18369556-18369578 TGGCATCTGAGCCTGGCTGAGGG + Exonic
1168113737 19:54209332-54209354 CGGCCTCTGAGTGATGCTGAGGG + Intronic
924975393 2:169460-169482 TGACTTCTGAGCGGAGCTAGAGG - Intergenic
927863938 2:26576928-26576950 AGGCTTGTGAGAGAAGGTGATGG - Intronic
930051354 2:47218524-47218546 TGGCTTCTGCTTGAAGCTGCTGG + Intergenic
931264686 2:60650196-60650218 TGACTTCTGAGCTAAGCTCCAGG - Intergenic
934739035 2:96705774-96705796 TTCCTTCTGAGCTGAGCTGAGGG + Intergenic
935152471 2:100450157-100450179 TGGCTACAGAGAGAAGCTTATGG - Intergenic
935555033 2:104500383-104500405 TGTTTTCTGAGCAAAGATGAGGG - Intergenic
938971827 2:136439749-136439771 TGCCTTCTGGGAGGAGCTGAAGG + Intergenic
939674050 2:145049861-145049883 TGTCTTCTGAGCTAGACTGAGGG - Intergenic
943789008 2:191910952-191910974 TGGGTTATGAGTGATGCTGAAGG - Intergenic
948021383 2:234736462-234736484 TGTCTTCAGAGCAAAGCAGAGGG - Intergenic
948220184 2:236263087-236263109 TGGCCTCTAAGGGATGCTGAGGG - Intronic
948995515 2:241576306-241576328 TGGGTCCTGAGGGAAGATGAGGG - Intergenic
1171099365 20:22368094-22368116 AGGCTTCTGAGGGCAGGTGAAGG + Intergenic
1173562839 20:44018514-44018536 TGGCTTCTCAGCAATGCCGACGG - Intronic
1174832627 20:53826794-53826816 TGTTTTCTGAGCAAAGCAGAAGG + Intergenic
1176100523 20:63362368-63362390 TGGCTGCTCAGGGAAGCTGGGGG - Intronic
1178424386 21:32467646-32467668 TTCCTTCTGGGGGAAGCTGATGG + Intronic
1182990831 22:34765952-34765974 TAGCTTCTGAGGGAAGGAGATGG + Intergenic
1183080394 22:35452206-35452228 TGGGTGCTGGACGAAGCTGAAGG - Intergenic
1184577401 22:45381607-45381629 TGGGTTCTGAGGGAGGCTGCTGG - Intronic
1185026548 22:48417434-48417456 TGGCTTCTGATGGAATCTGCAGG + Intergenic
949861790 3:8512118-8512140 TGGCTTCAGAGTGAAGCTCAGGG - Intronic
950947139 3:16960737-16960759 AGGCTTCTGAGGGAAGGTGATGG - Intronic
954801159 3:53187656-53187678 GGGCTTCAGAGCGAGACTGACGG - Intronic
954896096 3:53976238-53976260 TGGATCCTGAGGGAAGATGAGGG + Intergenic
955219511 3:57012029-57012051 TGCCTTCTGAGGGAACTTGAGGG + Intronic
956934446 3:74084058-74084080 GGGCTTCAGAGGGAAGGTGAGGG + Intergenic
964238868 3:154567621-154567643 TGGCTTCAGACAAAAGCTGATGG - Intergenic
965709667 3:171544380-171544402 GGGCTTCTGAGGAAAGCTGCAGG + Intergenic
965849531 3:173007206-173007228 TGGCTTATGAGTGAACCAGAGGG + Intronic
968992161 4:3921810-3921832 TTCCTTCTGGGGGAAGCTGATGG - Intergenic
969342518 4:6551093-6551115 TGGCTGCTGAGCTAACCTGTGGG - Intronic
969469692 4:7380314-7380336 TGGTTTCATAGAGAAGCTGAAGG + Intronic
972583882 4:40419261-40419283 AGGCTTCTCAGCAAAGGTGATGG - Intergenic
976590880 4:86848834-86848856 TGGCTTCAGAGAAAAGCTAATGG + Exonic
976711642 4:88078280-88078302 TGGCTTCTGAGCAAGCCTGTAGG + Intergenic
977748128 4:100576242-100576264 TGACAGCTGAGCGATGCTGAAGG - Intronic
978084318 4:104631803-104631825 TGGCTTCTGGCTGAAGCTGTGGG + Intergenic
978641659 4:110878116-110878138 TGGCCTCTGAGCTCAGCTGGTGG + Intergenic
982692930 4:158568107-158568129 TGGCTCAGGAGTGAAGCTGAAGG - Intronic
986517564 5:8580241-8580263 TGATTTCTGAGCAATGCTGATGG - Intergenic
986784505 5:11101017-11101039 TGGCTACAGAGAGAATCTGAAGG + Intronic
987171884 5:15267671-15267693 TGGCTTGTGATCCATGCTGATGG - Intergenic
987384107 5:17312532-17312554 TGGCTTCTTAAAGAAGCTGGTGG + Intergenic
988329402 5:29815393-29815415 TGGACTCTGAGCCCAGCTGATGG + Intergenic
990292597 5:54368072-54368094 GGGCTTCTGTTTGAAGCTGAAGG + Intergenic
997145536 5:131429012-131429034 TTGCTACTGAGAGAAGCTGGTGG + Exonic
998059830 5:139111205-139111227 AGTTTTCTGAGCCAAGCTGAGGG - Intronic
999696000 5:154189676-154189698 GGGCTTCTGGGCGATGCGGAGGG - Intronic
1004523015 6:16380177-16380199 TGGCTTCTGTTCTAAGCAGAGGG - Intronic
1006155933 6:32012763-32012785 TCCCTTCTGAGAGAAGCTGAGGG + Intergenic
1006162266 6:32045617-32045639 TCCCTTCTGAGAGAAGCTGAGGG + Exonic
1008011138 6:46469069-46469091 TGGCTTCTGTAGGAACCTGAGGG - Intronic
1010676489 6:78751903-78751925 TGGGTTCTGAGAGAAACTTAGGG - Intergenic
1012526824 6:100187875-100187897 TGGCTTCTGAGAGAGGATAAAGG - Intergenic
1013538034 6:111081382-111081404 TGGCTTTTGAGCAATCCTGAAGG + Intergenic
1015591735 6:134829154-134829176 TTGCTTCTGACAGAGGCTGAGGG + Intergenic
1017172334 6:151469043-151469065 TGGCCTCTGAGCCCAGCTGGTGG + Exonic
1018726802 6:166618957-166618979 GGGCTTGTGGGCGAATCTGATGG - Intronic
1019130235 6:169867966-169867988 TGGCTACTGGGCCATGCTGAGGG + Intergenic
1019483824 7:1278691-1278713 TGGACTCTGAGTGAAGCAGACGG + Intergenic
1020278858 7:6639927-6639949 TGGCTTCTGGGAGAGGCTGGAGG + Intronic
1020412578 7:7909334-7909356 TGGCTTTTGAGTTCAGCTGAGGG + Intronic
1023830953 7:44038816-44038838 GGGCGTCTTCGCGAAGCTGAGGG + Intergenic
1026567563 7:71501971-71501993 TGGAATCTGAGTGCAGCTGAAGG - Intronic
1029197537 7:98816333-98816355 TGGCTTCAGCACGAGGCTGAAGG - Intergenic
1029511656 7:100999291-100999313 TGGCTGCTGTGGGAAGCTGTAGG - Exonic
1029741287 7:102493125-102493147 GGGCGTCTTCGCGAAGCTGAGGG + Exonic
1029759277 7:102592294-102592316 GGGCGTCTTCGCGAAGCTGAGGG + Exonic
1029776646 7:102688204-102688226 GGGCGTCTTCGCGAAGCTGAGGG + Intergenic
1032810292 7:135407161-135407183 TGGCTTCTGGGCAAAGCGGGAGG - Intronic
1035994317 8:4529166-4529188 TGGCTTCTGAGAGTACCTCAGGG - Intronic
1036387610 8:8295627-8295649 TGGCAGCTGAGAGAAGATGATGG - Intergenic
1036504280 8:9341226-9341248 TAGCTTCTGAGGGAGGCTGTGGG + Intergenic
1037655632 8:20881701-20881723 TGGCTTCTGAGGGTGGCTAATGG + Intergenic
1037759785 8:21734132-21734154 TGGCTTCTGGAAGAAGCAGAGGG + Intronic
1038310722 8:26444339-26444361 GGGGTTCTGAGAGAATCTGAGGG + Intronic
1044323999 8:90839691-90839713 TGGCATGTTAGAGAAGCTGAAGG + Intronic
1046354901 8:113069837-113069859 TGGCTTCTAAGGGAAGCAGGTGG - Intronic
1049813756 8:144588472-144588494 TGGCTGCTGAGGGAGGCTTAGGG - Intronic
1053728251 9:41026171-41026193 TGGCTTCAGCGTGAATCTGAAGG - Intergenic
1057807358 9:98229078-98229100 GGCTTTCTGAGCGAAACTGATGG + Exonic
1060608800 9:124941536-124941558 TGGCTTGTGAGTGAAGCTGGAGG - Intronic
1061034907 9:128108040-128108062 TGGCATCTGAGCCCTGCTGATGG + Exonic
1062243364 9:135551347-135551369 TGGCTCCTGAATGAAACTGAAGG + Intergenic
1062381913 9:136290777-136290799 TGGGTTCTGAGGGAAGCTCCCGG + Exonic
1185783025 X:2865587-2865609 GGGCTTCTGAGGAAAGCTCATGG + Intronic
1187881980 X:23855836-23855858 AGGCTTCTCAGCTCAGCTGAGGG - Intronic
1192992397 X:76474321-76474343 TGTCATCTGAGCCAAACTGAAGG + Intergenic
1199503583 X:148536412-148536434 TGGCTTGTCAGCAATGCTGAGGG - Intronic
1200245587 X:154522666-154522688 GGGCTTCAGAGCGAAGATGCTGG + Intergenic