ID: 901625474

View in Genome Browser
Species Human (GRCh38)
Location 1:10622197-10622219
Sequence ACGGCTCCTTCGGGCATCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 59}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901625459_901625474 14 Left 901625459 1:10622160-10622182 CCAGTTGCCAGCCCTGCCCTGCC 0: 1
1: 0
2: 6
3: 87
4: 695
Right 901625474 1:10622197-10622219 ACGGCTCCTTCGGGCATCCCTGG 0: 1
1: 0
2: 0
3: 3
4: 59
901625460_901625474 7 Left 901625460 1:10622167-10622189 CCAGCCCTGCCCTGCCTGCCCCC 0: 1
1: 2
2: 54
3: 505
4: 2924
Right 901625474 1:10622197-10622219 ACGGCTCCTTCGGGCATCCCTGG 0: 1
1: 0
2: 0
3: 3
4: 59
901625464_901625474 -3 Left 901625464 1:10622177-10622199 CCTGCCTGCCCCCTTCCTGAACG 0: 1
1: 0
2: 0
3: 30
4: 257
Right 901625474 1:10622197-10622219 ACGGCTCCTTCGGGCATCCCTGG 0: 1
1: 0
2: 0
3: 3
4: 59
901625466_901625474 -7 Left 901625466 1:10622181-10622203 CCTGCCCCCTTCCTGAACGGCTC 0: 1
1: 0
2: 1
3: 15
4: 205
Right 901625474 1:10622197-10622219 ACGGCTCCTTCGGGCATCCCTGG 0: 1
1: 0
2: 0
3: 3
4: 59
901625462_901625474 2 Left 901625462 1:10622172-10622194 CCTGCCCTGCCTGCCCCCTTCCT 0: 1
1: 2
2: 15
3: 302
4: 2799
Right 901625474 1:10622197-10622219 ACGGCTCCTTCGGGCATCCCTGG 0: 1
1: 0
2: 0
3: 3
4: 59
901625461_901625474 3 Left 901625461 1:10622171-10622193 CCCTGCCCTGCCTGCCCCCTTCC 0: 1
1: 0
2: 13
3: 251
4: 1928
Right 901625474 1:10622197-10622219 ACGGCTCCTTCGGGCATCCCTGG 0: 1
1: 0
2: 0
3: 3
4: 59
901625458_901625474 23 Left 901625458 1:10622151-10622173 CCAAGAGCACCAGTTGCCAGCCC 0: 1
1: 0
2: 1
3: 17
4: 222
Right 901625474 1:10622197-10622219 ACGGCTCCTTCGGGCATCCCTGG 0: 1
1: 0
2: 0
3: 3
4: 59
901625463_901625474 -2 Left 901625463 1:10622176-10622198 CCCTGCCTGCCCCCTTCCTGAAC 0: 1
1: 0
2: 4
3: 73
4: 538
Right 901625474 1:10622197-10622219 ACGGCTCCTTCGGGCATCCCTGG 0: 1
1: 0
2: 0
3: 3
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901625474 Original CRISPR ACGGCTCCTTCGGGCATCCC TGG Intronic
901625474 1:10622197-10622219 ACGGCTCCTTCGGGCATCCCTGG + Intronic
901659060 1:10787426-10787448 ACAGCTCCTTCGGGAATTTCGGG - Intronic
1073143854 10:101266489-101266511 ATGTCTGCTTCGGGGATCCCTGG + Intergenic
1073404709 10:103287088-103287110 ACGCCACCTTCGGGAATACCAGG + Exonic
1075040671 10:119104485-119104507 CCGGCTCCGCCGGGCAACCCGGG - Intronic
1075395065 10:122121105-122121127 GCTGCTCCTTCAGGCACCCCAGG - Intronic
1076864935 10:133161830-133161852 ACAGCTCCTTCGTGCATCAGAGG + Intronic
1079362017 11:19777320-19777342 GCGGCCCCTCCAGGCATCCCCGG - Intronic
1081868485 11:46372490-46372512 ACGCCTCCTTGGGCCCTCCCTGG - Exonic
1083797585 11:65026400-65026422 AGGGCTCCTTCAAGCATACCTGG - Intronic
1085597163 11:77820662-77820684 ATGGCTCCTCCGGGCTGCCCGGG - Exonic
1103688718 12:122753067-122753089 AGGGCCCCTTCTGGCGTCCCCGG + Intronic
1104658188 12:130589951-130589973 ACGGCCCCCTCGGGCTCCCCAGG + Intronic
1104806194 12:131591014-131591036 GCAGCTCCTTCGGGTATCTCTGG - Intergenic
1116816212 14:49586109-49586131 ACGGCTACTACCCGCATCCCGGG + Intronic
1122783998 14:104155613-104155635 ACGGCTTCTTTTGGCATGCCCGG + Intronic
1122896401 14:104759708-104759730 ACTGCTCCTTTGGCCCTCCCAGG - Intronic
1125589362 15:40844678-40844700 TCGGCTCCCGCGGGCAGCCCAGG - Exonic
1127871533 15:63078009-63078031 AAGGCTCCTTCAGACCTCCCTGG - Intergenic
1129607462 15:77031799-77031821 ACGGCTCTCCCGGGCAGCCCTGG + Intronic
1132904242 16:2274004-2274026 CAGGCTCCTTAGGGCACCCCTGG + Intergenic
1134562313 16:15221111-15221133 AAGGCTTCTTCAGGCATCCAGGG - Intergenic
1134922853 16:18132738-18132760 AAGGCTTCTTCAGGCATCCAGGG - Intergenic
1138347247 16:56327571-56327593 AAGGCTCCTGCAGACATCCCAGG - Intronic
1141955114 16:87365570-87365592 AGGGCTCCTCCAGCCATCCCGGG - Intronic
1142251552 16:88994160-88994182 GGGGCTCCCTCGGCCATCCCTGG - Intergenic
1147561393 17:41511498-41511520 ACAGCCCCTCCAGGCATCCCAGG + Intergenic
1147661458 17:42119220-42119242 AAGGCTCCTTCTGGCCTACCAGG - Intronic
1151167689 17:72219359-72219381 CCGGCTCCTTGGGGACTCCCAGG + Intergenic
1163149266 19:15401393-15401415 CCGGCCGCTCCGGGCATCCCGGG + Exonic
1164872368 19:31656658-31656680 ACGGCTTCTGCCGGCATCGCGGG + Intergenic
925282850 2:2696837-2696859 AGTGCTCCTGTGGGCATCCCCGG - Intergenic
926784973 2:16509590-16509612 CCGGCTGCTCCTGGCATCCCTGG + Intergenic
932161720 2:69466239-69466261 ACGGCTCCTCCCAGCTTCCCCGG + Intronic
933760039 2:85666742-85666764 ACGGCCCCCTCTGGCCTCCCAGG - Exonic
1174484128 20:50850958-50850980 ACGACTCCTACAGGCAGCCCGGG - Intronic
1180711192 22:17840862-17840884 ACCGCTCCTCCGTGCATGCCGGG - Intronic
1184647449 22:45903799-45903821 AGGGCTCCTCAGGGCAGCCCCGG - Intergenic
1184759677 22:46537403-46537425 ATGGCTCCTCCGCGCGTCCCGGG + Intergenic
949414362 3:3799748-3799770 CTGGCTCCTTGGGGCACCCCCGG - Exonic
961577417 3:127849258-127849280 CCAGCTCCTTCAGCCATCCCAGG + Intergenic
962318035 3:134370932-134370954 ACGGCTCCTTCAGTTGTCCCTGG - Exonic
963228820 3:142889263-142889285 ACGTCTCCTCCCGGCACCCCGGG + Intergenic
966631321 3:182078449-182078471 AAGGCTCCTTCCCGCATCACTGG - Intergenic
985677744 5:1241000-1241022 TCTGCACCTTCAGGCATCCCTGG - Intronic
998616963 5:143751555-143751577 ACGGCTGCCTGGGGCATCCCTGG - Intergenic
1003137265 6:3443387-3443409 ACGGCTCCTTCCAAGATCCCTGG + Intronic
1003942527 6:11043888-11043910 GCGGCTTCCTCGGGCATCCCGGG + Intronic
1005854699 6:29852067-29852089 ACGGCTCCTCCGGGGAGCCAAGG - Intergenic
1018354747 6:163001015-163001037 AGGGCTCTTTCGGCCTTCCCGGG - Intronic
1019054614 6:169214064-169214086 AGGGCTCCTTCCGTCATTCCTGG - Intergenic
1033644255 7:143288549-143288571 AGGGCTCCTTAGGGGAGCCCAGG + Intronic
1035309323 7:157955102-157955124 ACGGATCCACCGGCCATCCCAGG + Intronic
1035435598 7:158856864-158856886 GCGGCTCCTCCGGGAAGCCCCGG - Intronic
1039840251 8:41287871-41287893 ACAGCTCCATGTGGCATCCCTGG - Intronic
1039944758 8:42119680-42119702 ACTGCTCATTAGGTCATCCCTGG - Intergenic
1041737847 8:61130820-61130842 GAGGCTCCTTAGGGCTTCCCTGG + Intronic
1059429522 9:114241465-114241487 TTGGCTCCTTCTGGCATGCCAGG - Intronic
1059483619 9:114611255-114611277 GAGGCTCCTTCCGGCGTCCCGGG + Exonic
1061194867 9:129102230-129102252 ACGGCCCCTCCTGGCCTCCCTGG + Intronic
1062446377 9:136597087-136597109 AAGGCTCGATCTGGCATCCCTGG + Intergenic
1186655696 X:11609523-11609545 AGGGCTTCCTCTGGCATCCCAGG - Intronic
1196717273 X:118823869-118823891 GCAGCTCCTTCGGGCAGCCCCGG + Exonic