ID: 901625774

View in Genome Browser
Species Human (GRCh38)
Location 1:10624189-10624211
Sequence CAGATAAATTAGATGGATTG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 190}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901625774 Original CRISPR CAGATAAATTAGATGGATTG CGG Intronic
901625774 1:10624189-10624211 CAGATAAATTAGATGGATTGCGG + Intronic
902083277 1:13836109-13836131 CAGATAAATTTGGAGGAGTGGGG + Intergenic
902754667 1:18541137-18541159 CAGACAAATTGGATGGGATGAGG - Intergenic
904721770 1:32515520-32515542 CAAATAAATAAAATGAATTGTGG + Intronic
905545459 1:38794980-38795002 CAAAAAAATAAGATGAATTGAGG + Intergenic
906773256 1:48504328-48504350 AAGTTAACTTAGTTGGATTGTGG + Intergenic
906925685 1:50113772-50113794 CATATACATTACATGGATGGGGG - Intronic
908157870 1:61374688-61374710 CAGGTAATTTAAATGGCTTGGGG - Intronic
908337634 1:63143856-63143878 CAGATAATTTACATGGCTTCAGG + Intergenic
911744188 1:101421067-101421089 TAACTAAATTAGATTGATTGAGG - Intergenic
912053982 1:105571150-105571172 CATATTAATTAGCTCGATTGTGG + Intergenic
914442740 1:147721579-147721601 CAGATAAATTAGCAGCATGGAGG + Intergenic
916843865 1:168628514-168628536 CAGATAAAATAGGTGGTTTGAGG + Intergenic
917046068 1:170861493-170861515 CAGAGAGATTATATGAATTGTGG - Intergenic
917785373 1:178450398-178450420 CAGAAAAATTAAAGGCATTGAGG - Intronic
918738827 1:188101824-188101846 CAGATTATTTTGAGGGATTGAGG + Intergenic
920863383 1:209730423-209730445 CCAATAAATTAGATGGATTCAGG - Intronic
921300375 1:213745958-213745980 CAGATATAGTAGATAGAATGAGG - Intergenic
924238582 1:242020343-242020365 GAGATAAATTAGGTGTAGTGAGG + Intergenic
924272706 1:242350274-242350296 AAGATAAATTAGATAAATTCTGG + Intronic
924364458 1:243276275-243276297 AAGATAAAGTAGATGGCTTATGG - Intronic
924558532 1:245137977-245137999 CAGATGAATTTCAAGGATTGAGG + Intergenic
924702630 1:246469195-246469217 CAGATAGATGAGAGTGATTGTGG - Intronic
1063041910 10:2350050-2350072 CACATAAAATAGATGGCTTTAGG + Intergenic
1064368860 10:14733281-14733303 CAGATACATTAGATCGACTCTGG - Intronic
1064814676 10:19246166-19246188 CAGATAAAGTAGAGGGAGAGAGG - Intronic
1066333369 10:34449215-34449237 CAGATAAATTATCTTGATTGTGG + Intronic
1066712004 10:38246353-38246375 AAGATAAATTAGATAAATTCTGG - Intergenic
1067530013 10:47063607-47063629 CAGAGAAAGTATATGGAGTGGGG - Intergenic
1068468770 10:57432707-57432729 CTTATAAATTTGATGAATTGAGG + Intergenic
1069005969 10:63317776-63317798 CAGATAGAATAGATGGGATGGGG - Intronic
1070279279 10:75037125-75037147 CAGAAAAATTCAATGAATTGTGG - Intergenic
1070825772 10:79389768-79389790 TACAAAAATTAGATGGATGGTGG - Intronic
1070854116 10:79592624-79592646 CAGTTATATTAGAAGTATTGGGG + Intergenic
1071905380 10:90168229-90168251 CAGATAAATTGCATGTCTTGAGG + Intergenic
1073112684 10:101072018-101072040 CAGATAAAAGAGATGGATGGAGG - Intergenic
1073958716 10:108901696-108901718 CAGATAAAAGAGATGATTTGTGG + Intergenic
1074133350 10:110604754-110604776 CAGTTAAATTTGAGGTATTGAGG + Intergenic
1074825310 10:117210504-117210526 CAGATAAATTAATTGGACTTTGG - Intergenic
1078756136 11:14212173-14212195 CAGAATAATTAGATGGAGTCCGG + Intronic
1079186556 11:18243538-18243560 AAGATAAATAAGATGGAGAGAGG - Intronic
1079766340 11:24397876-24397898 CTGCTAAAATAGATGGCTTGAGG + Intergenic
1080932533 11:36826946-36826968 GATATAAATTAGCTTGATTGTGG - Intergenic
1082965675 11:58964185-58964207 CAGAGAAATTAAATATATTGGGG + Intronic
1085362342 11:75901568-75901590 TTGAGAAAGTAGATGGATTGTGG - Intronic
1086357457 11:86018586-86018608 CATAAGAATGAGATGGATTGAGG + Intronic
1086920781 11:92583890-92583912 CAGATGAAGTATTTGGATTGGGG + Intronic
1087060132 11:93969315-93969337 CGGATGAATTAGATGGACCGTGG + Intergenic
1089609023 11:119659276-119659298 GAGATAAACTTGATGAATTGAGG - Intronic
1090786670 11:130054748-130054770 CACATAAAGTAGATGAATGGTGG + Intergenic
1090999560 11:131897741-131897763 CAAAAAAAGTGGATGGATTGTGG - Intronic
1093756406 12:22857921-22857943 CAGTTAAACTAAATGGAGTGGGG + Intergenic
1093970115 12:25368879-25368901 AAGAAAAATTAAATGGATGGAGG + Intergenic
1094418905 12:30249254-30249276 TAGATCAATTAGATAGAATGAGG + Intergenic
1094448262 12:30556908-30556930 CATACAAAAGAGATGGATTGTGG + Intergenic
1095495629 12:42780783-42780805 TAGATAAATTAGAGGGAATTTGG + Intergenic
1098769003 12:74528654-74528676 CACAGAAATGATATGGATTGAGG - Intergenic
1099384003 12:81992007-81992029 CACAGAAAGTGGATGGATTGAGG + Intergenic
1103857068 12:123978978-123979000 AAAATAACTTAGATGGATTAAGG + Intronic
1106945535 13:34823716-34823738 CAGATGGATTAGAGAGATTGTGG - Intergenic
1108540251 13:51436950-51436972 TACATACATTAGATGGACTGGGG + Intronic
1109702320 13:66042565-66042587 GGGATAAATGAGTTGGATTGTGG + Intergenic
1110986090 13:81971100-81971122 CAGATAAATAAGAAAGATAGGGG + Intergenic
1111149171 13:84226107-84226129 CTGATAACATATATGGATTGAGG + Intergenic
1111279086 13:85995466-85995488 GAGATATCTTAAATGGATTGAGG + Intergenic
1111284988 13:86077810-86077832 CAGATAAATTTGATAGCATGAGG - Intergenic
1111514466 13:89310290-89310312 CAGTTAAATAAGATGGAGTGGGG - Intergenic
1114214936 14:20649899-20649921 CAATTCAAATAGATGGATTGAGG - Intergenic
1116141195 14:40996237-40996259 CATAAAAATTAGATGAAGTGTGG - Intergenic
1116847784 14:49880811-49880833 CAAATGAAAGAGATGGATTGGGG + Intergenic
1117276159 14:54195847-54195869 CAGATGAATGAATTGGATTGGGG - Intergenic
1118491756 14:66267895-66267917 AGGATAAATTAGAGGGTTTGGGG + Intergenic
1119463179 14:74829210-74829232 CAGACAAGTTGGATGGCTTGAGG + Exonic
1120308331 14:82798760-82798782 CAGTTAAATTAGGTGGACTTTGG - Intergenic
1127069047 15:55270406-55270428 GAGACTAATTAGCTGGATTGTGG - Intronic
1128445534 15:67756476-67756498 TAGATATATTAGCTTGATTGTGG - Intronic
1133901147 16:9976292-9976314 CAGGTAAATGAGATGGCTTTAGG - Intronic
1134202425 16:12210097-12210119 CACATAAACCACATGGATTGAGG - Intronic
1137388559 16:48062157-48062179 AAGATAAAAAAGATGGGTTGTGG - Intergenic
1138398354 16:56725418-56725440 TACAAAAATTAGCTGGATTGTGG - Intronic
1139847448 16:69930887-69930909 CAAATAAATAAGATGGGATGGGG + Intronic
1140627246 16:76808979-76809001 CAGCAAAATTAGATGAATTCTGG - Intergenic
1140784626 16:78328591-78328613 AAGATAAATAAGATCGAATGTGG + Intronic
1142929723 17:3272926-3272948 CATGTAAATTAGCTCGATTGTGG + Intergenic
1143329759 17:6124899-6124921 TTGATAAATTACTTGGATTGGGG + Intergenic
1144261152 17:13522208-13522230 CAGATAAATAACATGGATTATGG + Intronic
1150660303 17:67069578-67069600 CATATAAATCAAATGGATTTGGG - Intergenic
1151056666 17:71039408-71039430 TAAATAACTCAGATGGATTGAGG + Intergenic
1153248981 18:3101631-3101653 ATGGTAAATTAAATGGATTGAGG - Intronic
1153462469 18:5351869-5351891 GAGAGAAAATAGATGGATTTTGG + Intergenic
1154090938 18:11362498-11362520 CAGAAAAAATAAATGAATTGTGG + Intergenic
1155981558 18:32185480-32185502 CAATTAAATTAAATGGATTTAGG - Intronic
1156700160 18:39815775-39815797 AAGATAACTTAGATGCATTAGGG - Intergenic
1159665142 18:71149418-71149440 TAGATAAATTAGATGTATATTGG + Intergenic
1165982727 19:39738229-39738251 CAGATAAAGACGATGGAGTGAGG + Intergenic
1166527876 19:43524564-43524586 TAGATAAATTATATGGTATGTGG + Intronic
1168415387 19:56164474-56164496 CAGCTAACTTTTATGGATTGGGG - Intergenic
1168525316 19:57084044-57084066 CAGACAAATGACCTGGATTGTGG - Intergenic
929026595 2:37610372-37610394 TAGACAAATTAGTTTGATTGTGG + Intergenic
930484713 2:51997897-51997919 CATATTAATTACATGGATGGTGG - Intergenic
938197707 2:129344786-129344808 TAGATAACTTAGATGAAATGGGG + Intergenic
938690074 2:133779537-133779559 CAAATGAATTAGATGTTTTGGGG - Intergenic
938719704 2:134055480-134055502 CAGATGACTTAGAGGGATTTGGG - Intergenic
939238512 2:139528915-139528937 CAGTTAAAATAGAGGGTTTGAGG + Intergenic
941093917 2:161213260-161213282 AAGATAAACTAGATGGTTTGTGG - Intronic
941542113 2:166799800-166799822 CAGATAAAGAAGAGGGATTGTGG - Intergenic
942586696 2:177487567-177487589 CAAATAAATTAGAAGGAGTCAGG + Intronic
942606708 2:177699672-177699694 CAGAGAAGTTAGATAGCTTGAGG - Intronic
946276444 2:218635328-218635350 CAAATAAATTAAATGGATCCAGG - Intronic
946915086 2:224510850-224510872 TAGATAAATTAGATTGGTTTGGG - Intronic
946934238 2:224702953-224702975 CAGACCTATTAGATTGATTGGGG - Intergenic
947512277 2:230767302-230767324 CAGATAAAGTGGATAGATTTGGG - Intronic
1171944160 20:31361299-31361321 CAGATAAATAAATTGGATTGGGG + Intergenic
1173918083 20:46724733-46724755 CAGATGGAGTAGATGGATGGAGG + Intronic
1174470686 20:50758273-50758295 TAGAAAAATTAGCTGGGTTGTGG + Intergenic
1176880879 21:14191661-14191683 AAGAGAAATGAGATGGATTCAGG - Intronic
1182194382 22:28500122-28500144 TAAATAAATTACATTGATTGTGG - Intronic
1182421423 22:30250522-30250544 CAGATAAATCAGACAGGTTGTGG + Intergenic
951329603 3:21350202-21350224 CAGACAAATTAGAAGAATTCTGG + Intergenic
951559533 3:23951993-23952015 CAGATGAAGTAGTTGGCTTGTGG + Intronic
953988223 3:47462203-47462225 AAGATAAAAAAGATGGATGGTGG - Intronic
955129547 3:56151495-56151517 CAGATATATCAGATGGTTTTGGG + Intronic
955559175 3:60170190-60170212 CAGGTTAATAAGATGGATGGAGG + Intronic
955733894 3:62016521-62016543 GAAACAAAATAGATGGATTGGGG - Intronic
956454486 3:69407457-69407479 CAGATAAAGTAGTTGTCTTGAGG - Intronic
956648388 3:71479766-71479788 CAGAAAAATTATAAGGATTAAGG + Intronic
956699890 3:71949509-71949531 CTGAAATATTAGATGGATAGTGG + Intergenic
958922436 3:100122104-100122126 CAGAGAAATTAAATGCATGGAGG + Intronic
958973815 3:100642676-100642698 AAGATAGATTAGATGGAAGGTGG - Intronic
961476540 3:127150300-127150322 CAGAGAGATGAGATGGCTTGTGG + Intergenic
961986064 3:131136373-131136395 GAGAAAAATTAGATTGAATGAGG + Intronic
964859781 3:161188390-161188412 CAGATATATTACTTGGATTATGG - Intronic
965507364 3:169531237-169531259 CAGATAAATTAATTGTATTCAGG - Intronic
966317296 3:178661963-178661985 CAGAGAAATTAGATGAATCAAGG + Intronic
966547053 3:181160985-181161007 CATATCAATTAGCTTGATTGTGG - Intergenic
970251886 4:14125547-14125569 TAGATAAATTAGGTGAAATGAGG - Intergenic
973115249 4:46449577-46449599 CTGATATATTACCTGGATTGTGG + Intronic
973230030 4:47830273-47830295 CAGATTAATTAATTGGCTTGAGG + Intronic
973902018 4:55485117-55485139 TAGATAAATTAGCTGGCTTGTGG - Intronic
975112304 4:70641705-70641727 CAGAAAAATTAGGAGGATGGAGG + Intronic
975234191 4:71972206-71972228 CAGACAAAATAGATGAGTTGAGG + Intergenic
975457058 4:74604549-74604571 GAGATATACTAAATGGATTGAGG + Intergenic
976555729 4:86449262-86449284 CAGATGATTTTGATGGATTATGG - Intronic
978921325 4:114186348-114186370 TAGAGAAATTACATGGAATGAGG - Intergenic
979813945 4:125075211-125075233 CAGATAAATAAGGTGGAAGGAGG - Intergenic
982031356 4:151304317-151304339 CAGAAAAACTAGCTGGATTGTGG + Intronic
982563106 4:156955429-156955451 TAAATTAATTAGCTGGATTGTGG + Intronic
983711267 4:170719620-170719642 AAGATAAATTTCACGGATTGTGG + Intergenic
983880001 4:172922445-172922467 CTGATAGAGTAGATGGATTTAGG - Intronic
986493326 5:8316523-8316545 CACTTAAAGTAGATGGTTTGTGG + Intergenic
989142583 5:38216643-38216665 TAGATAAATTAAAAGGCTTGCGG + Intergenic
989148312 5:38270837-38270859 CATATTAATTAGATTCATTGTGG + Intronic
992205699 5:74428324-74428346 CATATAATTTAGATGATTTGTGG - Intergenic
992538267 5:77734461-77734483 CAGATAACTTTGAGGGATTCAGG + Intronic
995770730 5:115666072-115666094 CAGAAAAATTATCTGGATTATGG - Intergenic
998314102 5:141164592-141164614 CAAATTAATTAAATGGCTTGAGG + Intergenic
999514475 5:152287182-152287204 TAGATAAATTACATGAATTTGGG + Intergenic
999714105 5:154345249-154345271 CACATTAATTAGCTTGATTGTGG - Intronic
1000790959 5:165606711-165606733 CAGAGAAATTAGAAAGATTTTGG - Intergenic
1004306060 6:14502829-14502851 CATATTAAGTAGATGGATGGAGG - Intergenic
1006292415 6:33149482-33149504 CTGTTAAATTACATGAATTGAGG - Intergenic
1008616252 6:53229345-53229367 CAAAAAAATTAGCTGGCTTGTGG + Intergenic
1009476577 6:64099065-64099087 AAGATAAATTAGAAGGATTGAGG - Intronic
1010808747 6:80271654-80271676 CAGATAGCTTGGATGGATTTTGG + Intronic
1012228506 6:96732647-96732669 CAGATAAATTTGGAGGATTCAGG - Intergenic
1012630698 6:101463530-101463552 TAGATAACTCAGTTGGATTGTGG + Intronic
1014746170 6:125203406-125203428 CACACAAAATAGATGCATTGTGG - Intronic
1014855993 6:126401668-126401690 GAGATAAAGGAGATGGATTTGGG + Intergenic
1015763856 6:136694570-136694592 CAGGGAAATTGGAAGGATTGTGG - Intronic
1015772814 6:136786221-136786243 CAAAAAAATTAGCTGGAATGTGG + Intronic
1017952856 6:159151128-159151150 GAGAACAATTAGAGGGATTGGGG - Intergenic
1018614431 6:165673180-165673202 CAGATAAACTAGATGGAAGAAGG + Intronic
1022040724 7:26579040-26579062 CAGATAAATTGGATTTATTCTGG + Intergenic
1022143625 7:27514982-27515004 CAGGTAATTCAGATGGATAGCGG - Intergenic
1023198688 7:37669567-37669589 CAGTAAAATTAGCTGGATGGTGG + Intergenic
1023343154 7:39243788-39243810 GAGACAAATCAGATGGATTCTGG - Intronic
1024189467 7:46991093-46991115 CAGATAAATGAGATGGCTGCTGG + Intergenic
1027443821 7:78248624-78248646 TAGATAAAATAGATTCATTGGGG + Intronic
1027502455 7:78970045-78970067 CAGGGATATTAGATGGAATGTGG - Intronic
1027659557 7:80972704-80972726 CAGCTAAATTATTTGGATTGAGG - Intergenic
1028802170 7:94978741-94978763 CATCTAAATTAAATGGATTCTGG - Intronic
1029000312 7:97147111-97147133 CAGATAAATTATCTGTATTTAGG + Intronic
1030336767 7:108337107-108337129 CAGAAAAATTAGCTGGGCTGGGG + Intronic
1030965306 7:115985599-115985621 CATTTAAATTAGCTGGTTTGGGG + Intronic
1031352609 7:120753602-120753624 CAGATAAATTAAAAGAAATGGGG + Intergenic
1032241908 7:130168510-130168532 CATATATATTAGATGGAATATGG - Intronic
1032847910 7:135767716-135767738 CAGGTAAATTTGGTGGATTTGGG + Intergenic
1039080271 8:33727172-33727194 CAAATGAATTAAATTGATTGGGG + Intergenic
1039187593 8:34934494-34934516 AGAAAAAATTAGATGGATTGAGG - Intergenic
1042974875 8:74457265-74457287 CAGGTAATTAAAATGGATTGTGG - Intronic
1044488757 8:92786975-92786997 CAAATATATCAGATGGATTATGG + Intergenic
1048612842 8:136042453-136042475 CAGAATAATTTGATGGATTCTGG + Intergenic
1048790538 8:138099434-138099456 GAGATAAAAAAGATGGATTTGGG - Intergenic
1050136898 9:2475050-2475072 CACATAAATTACATGTTTTGAGG + Intergenic
1050796507 9:9551793-9551815 CAGATACATAAGTTGGTTTGGGG - Intronic
1051293950 9:15575112-15575134 CAGATAAATTAGAAAGAGAGAGG + Intronic
1051871711 9:21745587-21745609 CATATAAATTTGATGGAGTGAGG - Intergenic
1052253364 9:26425991-26426013 AAGATAAAATAGAGGGACTGTGG - Intergenic
1186013960 X:5169574-5169596 TAGAGATATTAGATGGAGTGGGG - Intergenic
1189022576 X:37356515-37356537 CAGATAAGCAAGAAGGATTGTGG + Intronic
1191692058 X:63950584-63950606 CACAAAAATTAGCTGGGTTGTGG - Intergenic
1191978464 X:66899738-66899760 CACAAAAATTACCTGGATTGAGG - Intergenic
1192889296 X:75371417-75371439 GGCATAAATTAAATGGATTGTGG - Exonic
1195327656 X:103771105-103771127 CAGAGAAATGAGATGGTTTCCGG - Intergenic
1196008571 X:110862009-110862031 TAGATAAATTGTATGGAATGTGG + Intergenic
1200425847 Y:3019633-3019655 CAGCTAAATTAGATGGCTGGAGG + Intergenic